Description :
From Genome Similarity Track
Location :
scaffold_103:20015- 22701
Transcript NameFunction/comments
g13049.t1hypothetical protein
g13050.t1 hypothetical protein PHYSODRAFT_339765

Sequence
2686 bases(100 bases per row)
GGCCTGGAAGCTCGGCCTGGAAGCTTGGATATGTAGTTTGGAATGCTATATTTATAACTATAGCCACCTGTCGAGCATGTGATTGGTGGATGATCTAGAT
CGGACAACGAGGTGGCTGGAGCTCCACGCAGGTGCCGGCGCTCCCCCGTGATCTACAGAGCCGTCCGACCGCATTACCATGAATCTGAACAGTGTTGTGC
GAGTTGAACCCTGGTGGCGACTACGCAGTAACCTTGTGCTTCTTGTTGTAGACCTTCTCATAGCCGAACCAATCCTGATAGTTCGGGTGAGTCTTCATGT
CTGATACGAAGTGGAGTCCCAACAGCTTCTTAACTTCCTCTGGCGTTTTACCCTTCAGCAGCCAATACTTGTATCGCACCTTCAGCGACAGCTTGTCGAG
CATGTTCAAGATTGAGGAGCCTTTGATCGCCTGCCGAGCCATGCTCTCAACATGCGACGGCACTTTCAACAAACTCTCAAGCTCACTTTGAACAATACCC
ACTCCCCTCTCTTCATCATGCGTGGCATCGCCGTCTTCGTGGTCCATCTTGTCCGTTCGCAAAAACCTTCTCGCAACGGAGTCATTCTGGTCAATTGGCA
GCATGCGACTCGATGTGGCCGAAGGCAGCAGAAGAGGTTGTTTGATATCTGCCGAGTCTGTATCAGCAGTTGCGTACACGACAAACGCTGTCAACAGGAG
GAGGTCGTACAAACGCATGGATGTATTGACGAGGATTGTTCTTCTGGCCTTGGAGGTTGAGTCGCGAAATGAGAAGTTTTAGAGATGGGTAGCGCCAGTA
AATGCAGTGTGTGGATTCCTATATACTGCCCAGTAGGCAGTGCCTACACAGCCGAGGATCCCGCAAACCGTATTTCCCATTCTCCCTGAGAAGCGACACC
CCCTGTCGATCCTAAGATCGGCTCAACCTCGCGAACGTAGACATAAAAGTATCACGTCCTCTGTGTTATTATACTTGATAACGACGTGCATGCCGTCCAG
CTGTGCTTGACATCAATGTGCATGACTTTCAGCTGATGGAGGAAGGAATCCGCCATCGAGCAATAAAATAAAGGTTTTGCTACTCACGTATGCATCCCGT
TCCCTGTTTCAAGGCGACAAGGAGAGGGTCTACCACGACATGCAACGAGCATGAACGGCGTCAAACGCAGATGAGCCACAGCTGGAAATCCTTGCTATTA
GACTCCCTGAATCGAAAGATTGGGGGCAACTCATGATGGACTCTTGTCTAACTTCTGGTCTAACTTCTGGTCTAACTTCTGCAGGCTGCGAGGTTTTGCT
CGACTTTGAATCCCGAGTCGATACTCCCGTACTAGCCCTAGCTTCCTCATCACTGGTGACGCTTTTCGCATGGCTTGCTCCATGTCGTGATCAATAACAA
CCAGCTGGGAACCAAGACCGGATGGGACGCCTGCAGATAAGTTGCAGGACTGTATTGTCATACATGTATACAGTGTATGCGTTCCGTCCGATTTCCAATG
TTGGTTCATGTCTTGTGTTCACTCTACAATTTCCACTGCCGGCCAACACCCCTTGTGTTTCCGCTCTTGTGGTTCCAGATCAAGTATGCGCTTGCCTAGC
TTGTTGTTAACCGCTGCATCGATTATGGTGCTTACTACCGCCAACACAACAATCGAACCCGACCAGTCCTCGATTTCAAAACCTCTTGATACGGGGTCGG
CCGCAAGCCACGAAAGACTTTTGAGAATCGTGAAGACCGTTAACGAGGATGATGAAGGAGATCGAGAGGAAGAAAGAGGTGGCTTTAACTTCGGCTCATT
GACCAAGCTATTCAAGTCCTCATCAAAGACGAAGAAGGCAGCCCAGGTAGCTTTGGCAGCGGAAAAGCAGAAAAACTTCAAGACGTACGGAAAGATTCTT
GAGTACGACCACGTCCTGTATCCAGCGATGGCGACATGGCGTACGGAGGGCTTATCAGGAACCAAGATTTACAACGAAATGATTGCTGCTGGCAGAACTG
TCGACGAGGCTAGGACCGTCTTCATGCGCTACAGCACGTATCTCCAGGAGACGATGCACATCGTCAAAACTGCAAAGGATCTGGAGATCTCACAAATGCG
CCAGATGTTCAAGGACATCGCCAAAAGCGACGATACTCTTTACAAGAACATGGCGCAGTGGCGTAAGGACGGAGTTTCAGCGTCGTGGATCTACCGCCAA
ATGACAACAATTGGTGGGAGACCCAGTGGTGAAGCTGAAACCGTATTCAAGCGCTACAGCAATTACCTCCAGGAGGTGCGTCCAAGTAGTTGAATGGCGA
AGACATGCAGTGTTGAAGCAAAAGCCTTCCAGAGAGATGGATCTATATTTTTTTTCTTTTTCAAAGGGTTATGTAGTCAACGACAAGAGAGGTGGATCTA
CAGTATCACACGACTCCAAATCTGCGGTATCTATATATTTCTGTCAGATTCCAAGAAAAAACTATTATTTCATTTCTCGTTGAGCATGTTCAAGATTAAT
CGCCTGCCCGGTCACACCCTCAACGTGCGAAGGCGCTTTTAGCAAACTCGCAAGCTCGCTCTGAAAGTTAGCCACCACCCTCTCTTCGTCATCAGTGGTG
TCGTCGTCCTATCGACCCGCCTTGTCCGTTCGCAAAAGTCTTCTCTCAACGGAGTCATTCTGGTCAATTGGCAACAAAGTTCGAGC