Description :
From Genome Similarity Track
Location :
Scaffold_3:2001485- 2009442
Sequence
7957 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTTAATCCACGCCACCGCGGGTAGGCTACCTCAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACGTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGCTGGGTGTA
CACACGGGAAGCAACTTCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGATCACGGCGTCCCTAGTGGGAAGCCCACTCA
ATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGAT
TCAAGTGGCTCTTCAGGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AACGGACCAGCTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGG
AAAGACTCCGCAGACGGTCCTTCCCCGAGCCCGTCCTCAAGGTTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACTAAGTCTTAGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGG
CGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGACTCTGGGGCGTCGAAGAATTTCGC
ACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAATGCAAGGGCAACAGGACGGTGTCAGTGCGACTGGCCGACGGGAAG
GTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATA
TTATTATGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCACT
GGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATAT
GACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAGCTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGGCAG
CTGCAACTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATA
CGCTTCCTGTGTGAGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGAAAGGCGCTGAACACGCTTCCTGTGTGGGTAACACAGTGCCA
CACGCGGTCGCTCGGACCTTAACCGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCATAGTACCACACGAGGCCACGAGTGCCTCGGATGTCG
TAGCGACGACATCCCTAAACGTGGGCAGCAAAGCTCCCCGTCACAGCCGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCC
GATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGTGAGACCGGTTTA
CCCGTCAAGGCATCTGGTGTCCACTTGGAACCGCTACCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCA
AGGCTGGAGAGTTTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGAAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACAT
GAACAAGCAGCGTCAAGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGACCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAA
CACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATCGATCTCATGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGC
GCGAGCAGTGCGAGGTTATTGATGCCTTCTTCGCCGCGAAAGCAAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGT
TCGTAAGCCGAACGGAAAGTGGAAGCTGAACAACGCAGCGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGC
GTACTGTACAGTGCGCTGGATTTGGTAAGCGGGTACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGC
TTTGGAAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACA
GACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAAATGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATG
CGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCTG
ACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAG
CGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGAACCCGGATGCTTTTGACAGCATC
AAGGCCAGACTCCAAGAGGCCCCTGTTCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTTGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCAT
TGCTGCAGGCCAACACGGCTGGACACGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGGCAAGGAGCT
CCTGGCAATGAAATTTGCCCTTGTGAAGTTCCATGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCAACACAGACCACGCGTCCTTGAGGACGGCGACT
AACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTG
CGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATTACGCGGGTGACAGCGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGA
GGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGGCAGCGCTCACGGCTCCACCGATATGAGTTG
AAGGAGGGCCTCCTCTACTACCGGGTGAAGCCCCCTGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGC
ATGACGCGCCCTCCAGCGGCCACTCAAGCCGCGAGAGGACCTTTCTGTCGGTCTCTCAGTCCTTCAGGTGGACCCACATGTACAAGTGAGTCGCCCGGTA
CGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATG
AGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAG
TTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTTTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCC
GCGGTTCACTGCTGCGTTTTGAAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAG
CGCGCCAATCGAGTGCTCGAGGACACTCGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAA
CGCGGTGCACGCTTCCACGGGGTTCACGCCGCTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATT
CTAAGTGGGGGAAAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGC
TGAGCGTGATCAGCAGGGTCCGCGATGCCATGGCAGCGGTCCAGGACAGACAAATGCAGTACTCTGACAAACATGGAAGAGGAATCTTAAGTGTATTTAA
GGTGGGTGAACTAGTGTTACTAGACACAAGGAACCTACCGCTAGACACGGTAAGCTCTGTCGGCAGCAACAAGCTAAAGCACCGCTTCATCGGACCTTTT
GCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTGCTTTG
ACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGTCGTCGGAGCAGGCACCCAA
GCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGAACCCCGACGCCATACGCCGAGTACGCTGAGTACGCCG
GGTACGCACCATACGCGTACGTCTGGGAGTGGGCTGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCAGATCATGCGAAAGGCCTCGTCCAG
ATCGGTCGAAAAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAGCAGGCCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGA
TTCCCGGCCTGGGCGGCAGCATTACCGCCAGTTCCAAGGCCAAGTGCAATCTCAAGCATGAGGACACGTTGACGGATGCGGTCAACCTCAGGGTCCTGTG
TCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGAAATG
GAGAAGTCTACTACCACGTGAAGCGGATTCTCCAGGAACAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAA
CTCGTGGGAACCGATTGAACGGCTTCTGATTGACTGCCCAAAGGCTGTCGCAACCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCT
TGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGTATACGCTT
GCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGATTTCCCGTAACTCCGTGGGTGAGTAC
TTAAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGTGGATAGAGAC
CACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATAGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAGCAACTG
TTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCA
GAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTCGCTGACGGGTGCTACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGA
ACTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTTCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGA
GGAGTCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCT
TTAGAGGCCTTAGCACGCGCAAGACCCTCGTCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCGTGA
CGGCCGGACTCTCAGAGCGCACAGTCGTTCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGG
TCTGTGCCCTCCCACAGAGTCCGCAGGAGCATCGTGGGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAGCTCACGTTCCACGAACCGAGGG
TTCGGACGATTATCTGAAGACGAGGGCGAGGGGCTGCGGCGATTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCA
CCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTTTTGGCCTGCGCCTTACCGGCAGCGGCCTTGGAACGTGTCTTAGCACCGCT
CTTTGCAGTGCCACGAGGCATGGTAACGGTCGAATTGGAGACCTAGACGAAGAGCGCACAGGTTGTTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGC
CGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAGCCGAACCTAAGTGG
GGGAGGATGTAACGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTT
GGTACAAGGTATTAAGGTCGTTCAAAGCCAACCATTGGTTAAACGACATTGCAATTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAACTTAA
CCTACCTATAAATATACTCAGTTTACAATCTACCTTATATAGGTCACTTCGCTCTCTTTAAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTT
TGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA