Description :
From Genome Similarity Track
Location :
Scaffold_29:20011- 21972
Transcript NameFunction/comments
Phymu_g1795hypothetical protein PHYSODRAFT_310914
Phymu_g1796hypothetical protein PHYSODRAFT_463651

Sequence
1961 bases(100 bases per row)
AATTATTTCCTACATCAAGGCAACGCATCTTACCTGCCCTCCCCTGCCTTGGGTGAGATTGAGAGGCAGTCCGTGAGCGGCGCCAGTTGCACCAACATGG
CAATCTTTGTACTGTCCTCTGTCACAGTCTTGGACTCACTTGCAGAGATAATACTCACGGGCTTGAACGTATCTGCCGCGGAGTTACCCAACTTCTCGTT
GAGCGAGTTGACCCCCAATTCACAAGTACTGAAGAGCTCCATACACGATGCCGTCGTGAGCAGTGTCGCCATTTCTAGCCCTAGGCATTCATTAAAGTCT
GCACTAACACCTGCAGCCCAGCACAGGGCCGCGACCGCTATACACGTCGTCACTACAGGTAGCGGCTTCATATCGGATCTTCTTCGGTAGTGAAAGGTCG
CATTTGTACAATATGCGCTTACAGAGGTTACAATATGTCATACGATAGGGTCTTAATTCTGCCAATTAAGTGCATTTGACAATATGGCGGGGCCACCAAT
GCGGAAGGACGGCGATGTGCTCGCCATGGGCATCGAGGGCAGCGCCAACAAGCTGGCAGTAGGCATTATCCGCTACCGCGTCGATGGAGAGACGGAGATC
CTGTCCAACCCGCGCAAAACGTATATCACGCCGCCAGGTCAGGGCTTCCTGCCTCGCGAGACGGCTTGGCATCATCAGAACCACGTCGTGGGCATCGTGC
GGGCGTCTCTAGCCGAGGCTGGCGTTTCTCCGAAGCAGCTGGACTGCATCTGTTACACCAAGGGTCCTGGAATGGGCGGTCCGCTGCGTTCCGCTGCTGT
GTGTGCACGCATGCTGTCACTGCTGTGGAACAAGCCATTGGTCGGTGTCAACCACTGTGTCGGACGTACGTTGAGCATGATTGTACTGCTATTATCTCGA
CTTTTGGTGCTAATTTTGTGGTTATTGGTGTTATTACCAGACATTGAGATGGGCCGAACGGTGACGAAGGCGGCAGACCCCGTCGTGCTTTACGTCAGTG
GTGGAAACACCCAAGTCATTGCTTACTCAATGCAATGGTGCGGACTGCATTGATACTTGCGTCGTGAGGCGTCTTACTAATTAGCAATTATTCTGTATGC
TGCACAGCTATCGCATTTTTGGAGAGACGATCGACATCGCGGTCGGAAACTGTCTGGATCGCTTTGCGAGAGTGTTAGAGCTGTCCAATGACCCGAGCCC
CGGATACAACATTGAAGTGCTTGCGAGAGAGTGCGTGGTGTTTGTGCTTAGCTATGAGTGTATCTTTTCTGATCTGTTTCTATGACGCTTCTGCTGTATC
TTACTGTAGAGGCAAGAAGTTTATTGAGCTGCCGTACATTGTCAAGGGCATGGACGTGTCGTTTTCGGGCATTTCAACTttcatcgagaaggaggccaag
tACGTTTTGGAATATTTGATCCTTTCTACATGTTTCTAATTAGGAGCTTCTTACGCTACTCTAGCGACAAGATCAAGTCGGGGGAATGCACCAAGGCGGA
CTTGTGCTATTCGTTGCAAGAGACAATTTTTGCCATGCTGGTGCGTCATTTTACCTATTCACGATAGGATTTCCTTGGATTTTCAATAACGCTGTGATGA
TTCTTTTGTAGGTGGAAATTACCGAGCGTGCTATGGCTCATTGCGGACAGTCGGAGGTGCTTATCGTTGGTGGTGTAGGGTGCAACTTGCGTCTTCAGGA
AATGATGGGGGTTATGGCAAAGGAACGCAATGGTCGTGTCTGCGCTATGGACCATCGTTATTGCATTGACAATGGCGCCATGATTGCTCAAGCTGGAGTT
CTCCAATTCCAGTACGGAGAGGCTACGTCACTGAAGGATGCTACATGCACGCAGAGGTAAGAGacagatttttttttaatttgGTTCCAGCGCTTGCAAC
TTATTGGCGTGATGAAAATGTGCAGGTTCCGCACCGACGAGGTCCCCGTGATTTGGCGTTC