Description :
From Genome Similarity Track
Location :
Scaffold_1530:200- 2605
Sequence
2405 bases(100 bases per row)
ACCAATCCACATCCTTCTTAAGGAGATTGGATAATGGCTGAGCCATATCTGCGTAATTCTCACTGTACTTATGCAAGTAATCGGCAAGGCCAAGCCACTT
ACGTAGACCTTTTTTTTTTGGTTCTTTGGAACCGGCCAATCGACTATGGCCCTTATCTTGGCGGGGTCCGCTCGAAGGCCTCGCTTCTTAATAAAGCACC
CCAAAAGGGAATTTCTTCGGCACCGAAGATGCACTTAGATGCATTTGCATACAATTTATTCGTGTGCATGCACTCGAGCACCGCTTGTAAATCAATGTGA
TTATCCACAGCAGATCGACCGTTCGTTGCACGGCTATGGACAAAGATGTCATCAAAGTACGTTTGTGCATAGCCTCGGTGAGGTCTGAATAGTTGCGTCA
CCAGACGATTAAAAGTAGCCGGGGAATTGGACAGCCCTTGTGGCATAACGAGCCACTCCCAGAGCATATCGCTCGGGGCACTAACCGCTGTTAGCGGAAT
ATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGCGCACTGTACAATGTACATCCCACCATATTGTTCTGAAGAACATCCTTTCTG
GGGATTGTGTCTGAGCCGGGATAGTGGCAGCATTAAGCTTATTATAAGCGTGCACAATACGCCACTTACCATTAGGCTTTTTGACACAAAATGTAGGTGT
GGAATGGGGAGAATTACTCTCCCGCACCATTCCCGCCGCGTGCCTAGCACGAAAGAAATCGTCAATGACGTCACACTGTTCCTTAGGTACAGGCCACTGC
CGTGTTACGCAGTATTTAGTTCCTGGTACTAGGTCAATTTCATGACGTACACCTCTATCGGGAGGTAAGATAGATGGTGGGTTGTGGCACACCACATCTT
GAAATTCCTTGACCAAAGGATAGAATGGATCCAAAGAATCCTCAAGGATCGAAGATCCACTCCGGGCACTGACTGCCGCCTTGGTGTCCTCTAGGACGGA
CACGTCCATTAATGAGTACGAGCTCAACTCAACATCGGGTCTAATGACCACTAATTTGGATAAAATCCCCTGTCTTCAAGGCCTGGCTAGACTCGCCATC
AGACATTTCGTCTAGCTCACAAAGAGCATCCAAAGATGGAAGGGTTTCCAGGCTAACATTGCCCTCCACCTGGCCAGTCACTCCGTTGACAAGTGTGTAT
AGTGTATCACTATTGTCACTATGTGACTGCACGGACGCCTGGCGCTTAACAGTTGCCACCTGGTGTCCCGGTCGACTCTTCGATGAGACCTTACACCCCT
CTGGGGTCGGGACAATAGTGTCCCGTGGTTAATACTAGTAGTAGTACGCTCTATACGAGAGCTGATGTCATTACCGACATCAAGTGTGGTGCTTTCACGG
CCGACCGCACTCGGTGAATTTTTACGTGTCACCCCACAAACATCAGAGGAATCACATTCTTGATAACTCGGCCCTAGGCCAACCATGCTTTTAGCATGCA
GTGACTCGTTATCACAACGAGTAACACTCAACGGAGTATGCGCCGTCTCACTAACATTCAACGAGCTACGCTCGGAATTCATGTTTTCAGCATTGGAGTT
AGTTAACTCAGACATTTCAATGTCCAGCACATTGAATCTTCTTCTGTCAAACGCTCGCGCCAATAGTGCTTTTGTTGCCTAGCAAAGGTGGGACCATGAC
TCTCCAAAGCTTCGCCAGGAACATTGCGCGTAGCGCCTAAGGTCTTCGACCTCCAATCAATCCATGGCTCATGGCGTTCAAGCCAAGCCATACCTAGGAT
GAGATCATATCTTGAGTCCGAATCAAGGACAAGACAGCGTTCAATGCTATCAAAGTCCAAAAACTTTATACCTAAGTCCAAAGGAACTTTAGGTACAGTG
ACAAGACTTCCAGTCGCAAAACGAACCGTGATGGAATCACCCTCATGCGCTGTAAGCGCTTCAGCATAACGATGACTTCCCTCAAAGGAACGACGTCGAG
CATAATTTCAAGGCGCCCCAGAATCGATTAAAATTGACCAAGGCTTTTCAAAGCCTTTAACTTTCGCCTCAGCGACCAACAAGCCAGCCTTGTATCCACG
ATCCATACCAATAGGTATGGAACTCTTGGGGGCTAAGCCCTGTTCAACTTTACCTCCTAATGGTGTTACAGAACCTAGTTCTTCCCCAGTAGGGCTCCCC
GTGCCATGCCAGACTTCTGGCTCGGGGTAGAGTGTTGACTCGTAGCCTGGTGCTGTCTACGTAAAGGGCAATCAGGCCGTAAGTGTTTAGTGCTTCCGCA
CGTATAACACCGTCGTACAACACGTTGCTGCTCAGCAGCTTGAAATTTAACTTCACCTTCATCTTCAGCGTAGCTGAGATCCATCGGGTTCTGTCTATTA
CTCGT