Description :
From Genome Similarity Track
Location :
Scaffold_1217:20- 5526
Sequence
5506 bases(100 bases per row)
ATGGGTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTG
CTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGGGGTTCAGACAAGCCAAGGGAGGGGGCAAGATCAACAATGAAAAAGCAATCC
TACTTCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGGGTTGG
GATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGAATCAAGATCACGCTGGCAGGTTGCTTGGTATATTGGTTTGACATTTGGGTTGGAGATCTC
GCTGGTAAAGACGCCATCCTCGGGATGGATTTCATGGTGCCAGCGGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGA
TCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGATGATCATAAGGGCAGATAAGACCACCTGGATCGAGCCCGGGGAAACCTGGGAGTTGCC
AGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGGTACCTACCGTAATCCAGGGACCAGGTCGATCACAATACCT
CCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGGTAT
GTGTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAAATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGC
CAACTGGCCCCTTGGTGGATCGGCCTTCCTATCCAACTCCGCGAAAGATTCTGCAGAGGTATCGTCGGATGGAGGTCCAAGCGATGGAGGTTGGATCCAA
GACCGGGGATGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATCGCAGAAGGCTGGAGCCGGTCCGCCAGATCCCGCTGACCCC
AGAATGGATCCTAGCTTTTCATGAGGCCAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAGCCGTCGGCGTTTAAACTCGCTAGAG
GACCGACTAGATCCAACTGGTGGCTTCCCTGATACCAGGGTACCTGATCCCCCGAAGTCAGAAGGACTGCCAGGTGAAAGAGGGTCGCGGTGGTTGGATC
CAATGGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGCAGAGGATCTCGGGGATGGCCTGGCGGTAATCCC
GGAGGTACAACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCAACCGATCCCGCGGAAGTGGATCGGTTGCGTCAGAAAATC
TGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCG
CTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACCTCCTC
GTGGGCGTCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTTCATTGATTACCGGCTAGTTAACGGCCTGACACGATTGATGGTG
TATCCGATGCCTCTAATTAATGAGCTATTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTTGAGATGGTCAGTGGTTTCTGGGTGGTGACTATGA
CGGATCGAGCTCGCGCAATATCTGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCA
ACGCCTGATCGATAACGCCCTCTACGGATTGACCCGAATACCGGAACCCGAAAAGGGTGGATCCGGGGAAGATCATACGGAAGTGGATCCCTTCGAAGCA
GGATAGCCAGGGGATCCGGGGACCCCGTCTGTGTTGGGACGCAGATCGTATATCGACAACATTCTAATCCCGGCAGAATCGTGGGATCAGTTGTGCGAGA
AAGTGCCATTCCTACTGGATGCGTGTACTAAGTGGAATCTCTCTATCAGCGTGGTGAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGTGATCG
AGTCTCCAAGGAGGGGTTGGAGGCAAATCCTAAGGACCTGTCTTCGTTGGCGGACTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGC
AGTTTGAACTACAACAGTCGGTTCATCGAGGATTACGCACTGTTTGCCGCGGTACTATATGAATTGAGGGGGGTGGATTTTGCTGCGATGGCCACTCCAG
CTGTCAGGATCAAAATCCAAAAAGCTCTGGCCCTGGAGATGTCAGATCCACGAAGGGATCCAAGTAGTACGACGCCAGAAGAGGACCTAAAACAGGAGCT
GGATCCACCCCGGGACCAAAGGAAAGAGGATCAAACCTGGATAAAAACCACAGATCAGAAATCGGAAAGGGTGGAACCTCGGTGGATCCGAGCTCAACAC
GCATTCGTGGAGCTGAGGAAAACGGATCGCGACCACACCCATCCTCCGTCATTTTGATCCGGAACGTCAACCTACGGTGATAGTTTATTCCAGTGACTGG
GCGGTCTCAGCAGCCTTGGTACAAGAACATGAAGGGATCTGTCATCCAGTCACCTTCGTCAGTCGGACGCTAAAGACAAATGAACTGAACTACGGAGCGG
TGGAGAAGGAGATACTCGCGCTCCTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGC
TTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAA
GACGAGATTCTGGGGGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAAGCGCTGACTAGGATCACTCCTAAGAAAGAGCCCAAACGCCGGA
ACCAGATCCCGATCCCGACGGTACAGGTGGATGCGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGC
AATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTGCTG
GGTTTGGATCTACTAAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCCAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGG
CCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAAACACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGC
AGACCGCTTGGCCAGTGCTGATTTACGAAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGAACATCAGGATCTCGTTACGTTGAATCGACTAGACGAA
GTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCTGTCACTAGCTCCAGAGGAAGGATTGGATCCAGACCCCAGATCCTCGAGGAAACAT
TTGTGAAGAGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGAATGTACGAGACCT
GAGTCATGAGGATACCAAATCCCACAGTATTATCGCTACGGATTACGCAATAGATCTTAATGACTTGCTTTTTTATTGCCCCCCTACGAAGAGAGTCAAC
GAGTATCGGGATGGATTGATGAGATTGGTGATGCCAGAAACCTTACAACAGGATGTCCTACACCACTACCACGCTAGTTTAGAAGGTGGACATCAGGGGA
TTGGTCGGACCTACCAACGGATCCAGAAATGTTTCCACTGGAGGGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGG
CAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTCCAAATCATAGCCAAGGATCATATCCCCTCGTTGTTCAAGT
CGTTAAAAGGAAACACAGAGTTGTTGATCTGGGTGGATCTGTTTACTGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCCGA
ATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGACATGACCGAGAGCCAGGTTTTATGTCTGATTTCTTTCGAGCTTTCAAC
CGGATCCTGGGGCAGAGACAGCGAGCAACCATGGCATACCGTTCCCAAGCTAATGGGTCGGCCGAGCGCATGATGCAGACAATCACGAGAGCACTCAAGA
TGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACCCCCTTTCGTGATGAACACCGCCCAAGATAGGATCCGAGGTGATACCCC
GTTCTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGA
TACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGCCTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCC
GTCCACATCAAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTAGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGT
TCCGGGTGAGCGAAAAGATAGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGCT
GGTCAAGGAATATCCGGACCGGCCGCAAACCAGTCTTTCGGTGGATGAATCCGACCGAGTGAATTTCGACGAAGTCCTCCTACCGGGGGATAGTTGGAAT
GTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACGGACGGACTTACCGCGAATTTCTGGCGT
ACTGGCGTGGATATGACGAGCCCAGTTGGGTAGACGAGACAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGTAACAG
ATTCGGCGTGATGCAGTCTCATGCAGAATAGTAGGAAGGGGATCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGATGAAGGACCCACAGGAAGGG
TGTGGG