Description :
From Genome Similarity Track
Location :
Scaffold_2590:20- 2695
Sequence
2675 bases(100 bases per row)
CTCTTAAGTACTCACCCTCGGAGCTACGGGAACTCCATGAAGATCAGCTGCTGTCCCGCACCCTGGACCAGCGTGATCTTCGTGTTCGGTTTGTCCACAT
GGTCAGCAAGCGCATGCTGCCTAGGGACATTCTGAAGCGCGCGGCATCTAGCGCTCACATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTA
GACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGTACTATGGATCCAGTGTCGTCGCCGA
GGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGC
ATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATTTGACACAATCC
AGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGATCTAGTCCCGCCAGTGGACCAGA
CGGCCACAGGCTCTTCCGACACTTCCGCGGGCACCCTGCAACGGCACTTTGAAGCTGCGATGAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGT
GTCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTG
GATGGCCCATCCACTTCGTCAGCAGTGGTAGCCAACAGCACACAGCCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGG
ACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAGCGTCGGATGCT
GAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGC
GCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATGCCTACA
TCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGGTGGGGGATCCAAGGTACTGCGGGACCACGTGGATAACTTCATCGAGACGTTGGGA
GATGTGGATCCGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGATGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGA
AGAAGGCGGCGGTCAGATCCGGCAAGTATCGCCAAAAGGATCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAAC
TGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGTTCTGTCTCACTGCATCCAACGATCGAACGGCGAAGACAGGAGGCAACTCT
CGACCGGGGGATACCGTACCCGGGGACCGTGGAATGTACAGATCCCGAGATCTCATGGACGGGACAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGA
AGCACACTGAATCTGGATACTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGG
CGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTG
GCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCT
AGATCCAGGTAGCAGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTACCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTG
CCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGAGGAGAGGCACGTGGCTATTGGGAGTAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGG
TGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGG
TACTGGAAGTACCATGCCCCAGAAAAATGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCG
AGGTGTCTATAATGGATACCACCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGGTTGGTGAAGGCGTGTACCG
TACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTT
GGGACGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATG