Description :
From Genome Similarity Track
Location :
scaffold_623:20- 2001
Transcript NameFunction/comments
Pl_103373pol protein

Sequence
1981 bases(100 bases per row)
GCCGAAGGTCATGGGGACTGGGGCGGAGAAGCCTCGTACTCGTACGCGCACGAGAGCTCCACCTGCCCTCCTGGACCGGAACGGTGCGTTCCACTTCCAT
GTGGAACGGATTGTCCAGGAGCGCCGACGCTCTGGGAAGCGCCAGCTGCTTGTGAAGTGGCGGAGATACCCGCCTTCATAGAACTCATAGGAGCCGGAAG
ACCAGCTCCAGGCAGGCTGCCCGAAGCCTGTTGTGATCTGGGATCGAAGCAACGGCAGCTTCGTAAGTAGTCCGTGGCTTCTTAGCCGACTTACGGGGTG
CGGCACTAGAGTACATGCCTTATCTGCGCCCATCTTGGGCGCCTGACCGAGCGGTTTGCTTCAGTCTATCCACTGCGGAATGGAGTTGGCGCTTACCGAT
GAGGTGCGCAAACTCAATGCGAAGATCGTGCTGGCCCAATATGTGGCACAGCATCCGGTCCTCACGGAGTTCGTTCATCTCCTGAGCTGAGTAGCTCTGC
ATAGAGACCCAGCTCCAGAACAGGTTCTCAGCCTATGTAGGAGTTGTGGTGTTCTCGGGCTGTACCCAACGGTAGCCCCACACCGGAAAGAGTCCACCAC
GGTCCTCCGGCTTTTTGCGGAAGCTGGTGAACTTCTTCATAGGAATTCGATGTGCTGCTAGCAGCACACAGCGAGCCGCTTCAATGTCATCATTGAAGAG
AGGCTCCTCTTGAACGAGTGCTCGTTCGTAGGCCCCCAAGAGGTGCGGCCGTGGATCAAACCACGTGGAGCTCGGAGTCTCTCCAGGAACAACGGAGAGC
CCGAGCCCGCGTCGGGAGGATAATACCCCTCAGGGTACGAAGGCGTACTAGGGGCTAAAGGTGCAACCTCAGCCAAAGCTTGCGACTGAGCAGCACAGAA
TCGCTCTTGCTGCTCATCGAGATCGTTGGTGATCTCACGGGGCTCGTGTATAGCCCCTTCCTCCTCGGAATCAGAGCTTGCATCGAACAAGCTCCGATAT
TCTTTCGTATCCGTCGATCTCGACGAGGAGATCTTGAAGCCACGCGCTTCTTAGCGGCAGCAGCTTCTTCGACCGCTTTGGAAGAGGCAACTTCCTTGGC
GGCCTTCGCCCGAGCTCGACCCTCAGCTAGGGTCAAGTTCTTTCGGGAAGAGCCAGTAGACGATGGCTCAACCTTCCCCGACTTTGGGTTGGCCTTGGGA
TCATCAAAATCCCCTTTAGTGTCCGTCGCCGGCACACTAGCTGCAGGAGCCTTCGCAGGCTCCCCGGCTTCATCTCCTGAGTTAGACCCCGTGATCACAG
GGATGTGAAGCTCAGGGCTACTCGACCTCGAACTCCTGGAACCCGGGCTATGGTCGCGGTATGCAAACCGGGGTTCGGCCTGTTATCCGGTGACTGAGAC
CGGGAGCGACTACGTCGCGAGCTCCCGCCCTTAGAAGCGGCAGAGGCAGCTGAAGATCCGGTCGTCGCGTGAAGACCCCGAGTGGACTTCCTGTTAAGAG
GTAGCTTTGCCTCTCAGCTTAGCCGCCTTGGCAGTCTTCGACCGCGAGGGCTTAGACTTGGGTGGCACAATAGCGCCACGAGAGCTAGTCTTACAAGGCA
TACTTAGGGGTGGTTGACGTGGAAACCGGGTGCTTGGATGCACAAAGGCAAATGAATGCCACGAGGACCACTACGGTGGCTGGTCAATGGCAATCGACCG
AGAAGGAAATAGATTAGAAATCTCTTTCCGACTCCCCATTGGCTGGATAGTTCCAGTCTAAGTGGTGGAGGATGTAACGGGGTTACATTAGGGTGACCCA
CCGATTGGGTACACCCGTCTGAAGTGGACAACTTCAGGTCGGATCAGCCAAAGTGGCTGAGAGCCAACCAATGAGATTCGGCCAGTTTTATTTAGATCAA
GCTATAGTTAATTACAAATTTGTATTACAGACTAATCAGTGGCCGGTGAATTGTCAATAGTCACTATTTTGTATGAGTGAA