Description :
From Genome Similarity Track
Location :
Scaffold_4811:20- 1757
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4811-fgenesh-gene-0.1Conserved gene of unknown function
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_4811-abinit-gene-0.7Gene of unknown function

Sequence
1737 bases(100 bases per row)
CTATCTCACCGTAGTTGGAGAGCCGCTGGAAGCGCATCCTGCGGGCGTGCAGGAACACGCGCTGGTCGTCGTCGCCGCGGCGCGAGCGGTTGAGCACGGG
CTTGATCCACTGGCCAGTCATCTCGACGCAGAAGTCCATGGCGCGCGCACCGCTGCGCTTCATGGTCCACGTGTACGCGAACGAGTTGTCCCCGTGCAGC
ACCACGCGCAGCTCACCGTCGTTGAGCTCCGTGTTCCCGTGTCCAAGTGCTGGCGAGTGGGCTAAGTCTGAGCCCTTTTCCTGTGAAGCGGGGGAGTAGT
AGACGCCCGGGATGGACGTGTACGGTGGCATTGAGGCTGTAGAACCAGCGCTGGTGGCCTCACTGGGGACGGAGTGGGGCGACTGCTTCCAGCTCACGCG
CGCGTCGGCAGCCCTTAGCAGCGTCTCCATCGCGGCCTCGACCTGGGTCTTGAGGCGCAGGAGGTCGACTTTCCCAGCCATCTTGCCTTCTGCTTTGGGT
CTCTTGAGGCTGTCTGTTATCTCTCAGGGCCTCCATAGAGGCGTGCAAGCCGTTCGAGTTCGACGGCTATCTCTGGGGAAGGGTTGTCTTTATTTACCAC
CAGAAGCTGGAAAACCCTCGAGATTTCAGACTCACCGACTTACCGACTGACAGAACTTCTACTGGCGCTGACGATGGATGAACTGGAGCGAGAGCAGCAG
TGTGGTGACGATGAGGACGACGACGGCAGCTACGCGAACGCCTATCTGAACGACGATGAGAACGAAGCTGACGATGACGAGGACGACGACCTGGCGGTCA
TGTTTGCCAAGGTGAAGACCATTCAGCAGACCGAGGGTATTCAACCAAGCAGCTGTGTTAGCACTGCGCAAGCGAAGGCCAGGGAGCCACCACCTTCGCT
AGACGTCAAGATCATCCAGGCGACTACAGTGCACAGGGCATCGAATAACAGTCGAGCAAGCGGCTCGACACCCACCTCTGCGAGGAGGTTCAAGTTGCCG
TCGTCGGGTGGCGGAGTCGTGAGTGAGGACGGTATCAAGACCATCTCGCGCCGGACGCTGGGTTCTGCTGGAGTACCAGGCGGTTCTAGTGGGAAATGGA
CAGGACCTGTTGTTCGCATCGACGCACTGCTGAACGTGAAGAAGCCGGCGATCTACGAAGACAAGCTGCTCCAGTCCGTCAAATCCTCCGAACTGCTGGA
GAAACTCAAGATGAAGACGGCGCAGGCGGGTCCAGGTACGACATGACTAGTTCAACCTCTGATACTCGACATTGTTGATTTGTTGTACTGACAATGTTGT
TATGAATGCTTTCCAACACTGTATAGCCACCATTGCGGTACGAGTTGCCTCTCTCAGGACTTTTGTGATGTTGATAAGCTGATGACGTGACTTTGTTGGT
TTGGTATCTGCTTAGAAACGCATCGAGATGCTGTCGGAGCCCGCGAAGAAGAGCTCCTCGAGGCGGAAGTTCGCGACTGATGACGAAGAGCACCACTGCC
GCTTCAAGCCCAAGAAGGGCCCTGGAGCCAAGAAAGAGTCCTCGGATTACGATAACGACGCTGATGGAGGTAGCGAGCGGCGAAATGACTTTATCGCACG
CATGGAGGCGGCCGAGAAGAGCAAGCAAAAGGTACTTGGTATTGATACTTTTGATACTTTAGTATCAGTGGGCTTAGACTTGTGCATCTATTTGCTTAGA
AACTGGAGATGACGCGGGGCGAGAACGACTACAATGC