Description :
From Genome Similarity Track
Location :
Scaffold_1515:20- 1552
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1515-snap-gene-0.1Reverse transcriptase

Sequence
1532 bases(100 bases per row)
GGATCGCCCCTTTACAAGCGCTATCTGCGCGGAAACCTGAGCCAGCTGACCAGCCAGGAAGCAGAGGACTGTGGCAAGGTCGCAGAGCAGTACGAGGAAG
GTGACGGCGGATTGCTGTACTTCGTGGGACGATCCCATCGCAAGCACGCTGAGGGGCGCGGGGTCCAGCTACGTCTGGTCGCACCAACCACGCTCCATGA
CGAGATCCTGCATCACTACCATGCGAGTCTGACAGGTGGGCATCAAGGGATCTCCCGCACCTACGAGAAGGTTAAATAACACTTCCACTGGCGTGGGATC
TACAAGTCAGTCCAGCAGTACGTCGGATCGTGCATCGATTGCGAGACAGGCAAGGGCCAGCCGAGGATCCGCGGTGGATTCCCAGGAAACATCGTGGCGA
AGCGACCATTCCAAGTTCTTGGCATGGATCACATCCCGTCGCTACCGGAATCGCATCGCGGCAACACCGAGCTGCTATTATGGATCGACCAGCACTCAGG
CTACGTGATCGCGTCGGCCAATCCGAACCGTGAGGCCCAGACTGTCGCCGAATCGTACGAACACTGTGTGTTCCGCCGTTTTGGTGCTAGCGAGGTGATT
CGGCATGATCGTGAGCCAAGCTTCATGTCTGAGGTATTTAAGGCATTCAACCGGTTGATCGGGCAACAGAGTCGAGCGATTCTAGCCTATCGACCTCAAG
CCAATGGGATGACCGAGCGCATGGTGGGTACGATCACGCGAGCGATCAAGATGTATGTCCAAGACAAGGATCAGAAGGACTGGGACGAGTATNNNNNNNN
NNAGACTCGTGTTTGCGCTGAACACCGCTTATGACCGCACGAGGGAAGAGACACCACACTGACTCGTACACGGCTGGGATTCACGAGCCACGCTGGAGGT
GGCTATACCAAGAGCGGATCCAGGGATCTCAGCTAGCAACCCTAAGGTTTGGCGCAATATGGTCCAGCGTGACTACACATACGCGCGCGCGGCTGTCAAC
CATCTGCGGGAAGCGGCTATGCGAGATCGAGCTGACGAGGCCAATGAGATCGCGACTGGAGGCGATGGGATTGTCGTCGGATCTCAGGTGTGGCTATTCT
TTAATTGCACCAAGCCTGGTTACGCTCGCAAAATTGCGCACCTATGGCATGGGCCCTTCAGAGTGGCTGATCGACTCGGACATTACCTGTTGCGACTGGA
GATTCAAGGTTCAGAGTACCAGTTCTTCCCAGTCGTTCATATCAATCGCGTGAAAACACGACGTACCTACTCGGAGCGACCGGAAGCCGAACTCGTGACG
AACGACGAGCGCTTTGATTTCGATGAGGCTCTCCTACCAGAAGACAGCTGGGATCCGCTGGAAGAGACAGGTGAGTATGAAGTTGACCAGATCCTGGATC
AGCGGTATGAGAAGCGCACACGCCATGGACGTCGAATTCGCGAATACCTAGTCCAATGGAAGGGTGATTACCCTCCAGACTGGATCGCTGAAGATAGTTT
GAACTGCGGTGGTTTGATCTTCGAGTTTGAAC