Description :
From Genome Similarity Track
Location :
Scaffold_2941:20- 1172
Transcript NameFunction/comments
Phypl_g15507hypothetical protein

Sequence
1152 bases(100 bases per row)
TTACTGAacgtcggcgacgccgatgaGGATTTCCCGGCCGAGGTCGTCCAAgagcttgtcgccgctgATCACAACGACGCGGCCGCCGGCAGACAaacat
cttcttggcgtggGCGATGACCTCGGTGGTGGTCGGGGCGCGGTCGAGATAGTCCGGGACCATCGGGTACATGCCACGGTGGATCTGGAGCTGATGACCC
ACCTTGAGGTCCATGACGGGCCCCGTCGGCTTGTACTTGGCGACCGTGCGAGCCGTGTCACGATCATGAGCTGCGTTCATCTCGTTGTCTGGGTCTTGAC
GGCGGACGACACGGCCGACTCGACGTCCGACGTGGGCGAGTCGAACTGGAACTTggccggctgcagcaggagctggtcgacCTCCTTGATCACCGTGTTC
ATGGTGGCCACGGACTAAGGATGGGGTACTTGACCTGGGCGGATTCGTCGCTGAGCATGACGCCGTCCGAGGCCTCGGCACGCGTGGGGCGCGGGTTGTT
CTGCATGGACCCGAGCATCTGCGTGGCCACGATGACGGGCTTGCCGACGGCATTGCAGCGGTCCACCATCATACCTTGGAGATGATCTTGGGGCCGATGT
AGTCGGCCTGGCTGGCCCAGTGCTTCTTGATGCACTCGCCCACGAAGGAGCGGGTCTCGTgcacgtcgctggccttgcgggtgaaggaggcggcggtgaa
gTCGATGTCGTGCTCCACGCCCCAGTCGAGGTCGCGCTTGTCCTTATCAGGCAACGCGGGGAGCTCCACGATCAAgccgggggggggggggtcacgCCCT
TGCGGTTCCCGATCTCCTTCGTGTTGTTGATATCACAGGTGACCTCGTCCTTGCCCACGGCCGTGCACGTGAGGCGGATGAGGCCGtcggacagcagcac
cgtgtcACCCACTTTGACGGTCTCGGCCAGCTGCTGGTATGTCACGTAGAACTTGCCTTTGAGCTCGAACGCCGGGTCGgtcgtcagcaccaccgactTG
CCCCTCTCTacctcgatcttcttgccgtccaccATCTTGCCCGTGCGGGTCTCCGGGCCTTTGGTgtcgtgcagcacggcgcgcagGTTGAACGCGGCCT
GGCCCTCGGCGTGCACGCCTCGGCACGCGCGCAGGTTGGTGACGCGCAGGCC