Description :
From Genome Similarity Track
Location :
Scaffold_3003:20- 1128
Sequence
1108 bases(100 bases per row)
GTTACAGAACTACATGACAGATCTGAAGGTCTACACCTCAACTCGAGTGCCGCAGGGCTGCGCTGATGCAGCGTTCCACTTCCAGGCGACGGCCGAGCAC
GTGCTGGCCGAGTTTCTCAACAAGAGTGTACTCGTCTGGATCGACGACTTGTTGTTGTTTGCCGACAGCATTGAGGAGCTACTGGAGGTCATGGAGCGCG
TGTTCTTCTTGCTGGACACGCAAGGACTGAAGTTGAACCCAAAGAAGAGCAAGCTGTTCTTGACGGAGGTCAAGTAGTGCGGGAAGATCATCAGCGAGCG
TGGTGTGGGCTATGACTCGGAGTGCCTCGCGGCTTTGCAGAAGATACCATACCCGCCGACGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGTGGTAGGGCCATTGCAGGCGCGTTTGGACACGGCGCTCAAAGGGGACAGGAGAACGAAGATTGCTGCGGCTCATATAGCCATTGA
ACTGAGCGCCGACGAGAAGGCCAGTTTTGATGCTGTCAAGGTCCTCTTGTCACACTCGGCAGTGTTGACGTACTCGCTTCCCGATAGGCAAATGTGCGTG
CTCACGGACGCCTCGAGCACAGGCTGGGGTCTCGTGGTGACCCAGGTCCCAGAATGGACTCCAGCGGTTCCAGTTCAAGCCCAACAGCATGAGCTGCTGA
TCTGCATGGGCGGCACTTTCAAGAACTCGCAATTGAACTGGACCGTACTTGAAAAGGAGATGTACCCAATCACGCATGCTTGCGATAAGCTCGAGTACCT
GCTACTGCGATCACAAGGCTTCAAGGTCTACTGTGACCACCGCAACATTGTGTACTTGTTCGCGCCGGGCAAAGAGCTCAAAAAACATGTCCGCGGCAAG
TTGCTCCGATGGGCTTCCAAGCTCATGGGCTATCGCTACCAAATTGAACACACTAGTGGCGAGGCCAACTTGTGGGCTGATTTGATCTCGCGATGGGGTG
GCGCAGAG