Description :
From Genome Similarity Track
Location :
Scaffold_2603:20- 1102
Transcript NameFunction/comments
Phypl_g15245hypothetical protein PHYSODRAFT_423367

Sequence
1082 bases(100 bases per row)
AGAGAGCGGTACGCGCGATCCAGTATTTGCTTCCTCCGTCGGGATCGGACTCCAGCTTGGACGGATCCGGAGGATCTGATTCGGAGGGCGATCTACGTCG
GATCTACCTTGCATCGGCAGAAGCTACTCCACCTCCGGCAGGAAGCGAGACAGCCCAGGCAGATCGGTTACCACCGGGTCGGATCGCGACAGATCAGGTG
CCCCATGGTCGCagatcgctgctgcctcccgACGGATCGGATCGCAGTCGCTGTTCGCATTGTGGTTCCCGTAACTATACGGATCTGGACTGCTGGAAAC
GTTTGACTTGCCAAAAATGTGGTAAGCGATCAAGACTCAACTCAGGACCACACGGTGAGAAAAGACCGACCGGATCAAGAACGTGTCGGAACAGAGGACC
CGTCAGGCGATGGATCGATCTTCTATCATGAAGGAAGCGACTTTTGGCCGAAgatgtcgaagaagagctggcTGTGCTTCCGGAACTTAGCTCCAACGCG
ACGGACGAAGTGACGATCGAAGATATTCAAGTGGGAGATCCGAAGTATAATACCACTGAAGAGATTGACCGGCTACGTCGAATGATCTGGAAGAGGCGAC
ACCTCCTGATCGGCAAGGGCAATGCGTTGCCCCCAGCCGCCAGAGGCGTTGTTTGTGATATCAACGTAGGTGACGCAAGGCCTATCGCGCAACGGGTGCG
GAAGATCGCCCCGCAGTTCCGAGAGAAGGTGTCGGATCTGCTCAAGGGACTTCTGGCGGCCAAGATCATTAGACACTCGACGTAGCCCTNTCGTGATCAT
TATCAAGAAGAACGGAGTGGATATACGGCTGTGCATTGATTACCGACTGGTGAACGGACTTACGCGGCTGATGGTTTATCCGATGCCACTGATCAACGAT
TGGCTTGGACAAGGTCTTATGGTACTGCTCGTTGGATATGGCTAGTGAGTTTTGGGTGGTCACGATGACGGaccgagctcgagcgagctcaGCTTTCATC
ACTCCATTTGAACTGTTTGAGTGGAACCGAATGCCGTTCGGTCTCAAGAATGCACCGCAGATCTACCATCGACTGGTGGATA