Description :
From Genome Similarity Track
Location :
Scaffold_2694:20- 1059
Transcript NameFunction/comments
Phymu_g14271reverse transcriptase

Sequence
1039 bases(100 bases per row)
GAATTCCACTTCACGTAATTCGTACAAAACCGAGGCATAGACCGCGTAGTCTTCGATAAATCGGCTGTAATAGTTCAAATTTCCCAAAAACGACTGCATG
GATCGAAGCGATCCGGGAAACGGCAGATCGGTCAGAGACTTCAGATCCTTTGGGTTCGCCTCCAGACCTTTGATCGACACCCGGTGTCCGAAATATTCCA
CCTTGCTCACGCCCCAGAAGCTCTTTGCCACACTGATCGACAAGTTCCACTTATCGCAAGCTTCCAATAGATCTTCCACCCTTTGGCACATCTGATCCCA
CGATCCAGCGGTGATCATGATGTCGTCAATATATGATCTGCGCCCCAACACCGATGGTTGACCTGGATCTGCCGGGGTTCCGGCCTCAAACACATCGACC
AAGCTCTCTGAGTCACTCGATCGCGGAATTCTCACGAATCCATCTAAGGCGTTGTCCACAAGGCGTTGATATATCTGTGGGGCATTCTTCAACCCAAAGG
GCATACGATTCCACTCGAACAGGCCGAACGGAGTAATGAACGCTGAGATTGCGCGTGCACGGTCCGTCATTGACACAACCCAGAATCCACTCGCCATATC
GAGCGAACAGTACCAAAGAACTTTGTCGAGATTTTCCAGTAGGTCGTTGATCAAGGGCATTGGGTAGATCATCAGCCTTGTGAGGCTGTTCACTAGCCGG
TAATCGATACACAACCTGATATTCACACCGTTCTTCTTAATGATCACCACGACCGGGGATGCCCACGGGGATGTCGAAGGTCGGATAATCTTGGCTGCCA
AGAGGCCCTTGATCAGATCTGACACTTTCTCGCGGAATTGAGGCGCCACCTTACGCACTCGTTGCGCGATCGGTCTCGCATTTCAGACATCGATATCACA
AATAACTCCTCTGGCTGCCGGCGGTAGTGCATTTCCTTTGCCAATCAAGAGATGTCGTTTCTTCCAGATGATCTGTCGGCGTTTTTCGATCTCCTGCGGG
GTAGCGGATTCTGGATCGCCTACCTGTAGATCTTCGATC