Description :
From Genome Similarity Track
Location :
Scaffold_294:20- 1045
Sequence
1025 bases(100 bases per row)
CCCTGTACTTCACGTAAACTTTTAGCTCTGCAATCCGTCGGCAACATGGTCTCCACGCTTACTTCGTCTGTTGATTTTGGTCTGCCGCCCATCAATACCT
GTGGTTCTTGTAGCGATATGGGTCGCCCGCTCGCAGGCTGTGATGCGAGGACGTCCACCACTACCGCTTACAGCGAATCACATACGGTGTCTAGGCCCAG
CGTCAAGTTTATCGCTCAAAATGACGCTGCGGCTACCGTCGCATGATATCACTGAGAAGGAAAGGGTAAGAAGCGTCTCAGTGGGCGAGAAAATATTCAT
TAATTTTGCTAGCGTGGGGTCCCCAAAACTCGATCCAATACGTAGACAAACTGCAGCTCAGCAGGAACTACCTGGCTTAACTAAGAACTGTAGTACCTGT
CGCGCTGATGATACAAAAGAATCTGAACGCTTCTGGCTACTTTGCTTCTTTTGCTTGTCAAAAAAAAGACAACCTATTTTCTTGTTTCCGAGCTTAACTC
AACTTTGTTGCTATCTCTACAATATCATAGACATTTAGACAATTGGTGACGTGGTAGGCAAAAAAAAATGATACATTATGGATGATAGCGTGCAACAATA
GGATGCAGTCAGCTAAAATCCTTATACACGTACTCGTTTGTGATCTGCATCAGCGTGTTGAATATTATTTAACGAATCAGGTTCTCTGTCTCTCTTTATG
GTGTTGAATGTGATCAAGCTCAATTGTTTGTTCAGTCCATTTTTGTATTGTTGAATATTATTGCACGTTAAGCACGTCGAAACTGAGAGATCGCGTGTTT
ACTTCAGAATAAGTAAGTTTATCTCTGCGGTGGTGCAAGTAAATGAAAAGCATAGTTAGACATTTCTCACAAACACACAGCCCACAGCACAAAACTTACT
TCAGCGACGCCTGCTTCGCCAACAGCTTCTTTAATGTATTAGTTGTCTTGGGCTGGCTGGCATATAGCTCGCGAAGATTCTGGTTTTCAGCCTCCGTCTC
TATTCGGTGTTTCTTGTGCTTCATT