Description :
From Genome Similarity Track
Location :
Scaffold_761:2- 6660
Sequence
6658 bases(100 bases per row)
TCATGGAGCAATGCTCCACAGTTCAGATCTGCCTCGTCTGCCCAACTGGGCTCGTCATGTCCACGCCAGTACACCAGAAACTCACGGTAAATTCGTCCGT
ATCTAGTTCGCTTCCCTGACCTCATACCGGTAATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCCTCCGGTAGGAGGACTTC
GTCGAAGTCTACCCGGTCGGATCCATCCACCGAAAGACGGGTTTGCGGCCGATCTGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGG
AACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCAATCGTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGT
GGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACCTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCTGCTCGATC
CTGTATCGCACTCCGCAGCCGTTCGTTCACCTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTC
TTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGGTGTCACCCCGGATCCTGTCTTGGGCG
GTGTTCATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGAACAAACATCTTGAGTGCCCTCGTGATCGTCTGTACCA
TACGCTCGGCCGATCCACTGGCTTGGGGACGATATGCCATGGTCGCCCGCTGTCCCTGCCCCAGGATCCGGTTGAAGGCTCGAAAGAAATCAGACTTAAA
GCCTGGCTCCCGATCATGCCTAATCGTCTCACTAGCCCTAAAGCTTCGGAAAACGCACTCCTCGTATGATTCGGCAATGGTTTGTGCAGTTCTAGACGAC
TAGCTTTGGCTATCACGTATCCGGTAGACAGATCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGAGTAACGAGGGGATGTGATCTATGGC
TATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGCCTCCCCTTCAATTGTGGGCCTGCCCTTACCTGTCTCACAATCCACACATTCACCAACA
TATCGTTGCACGCTCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATTCCCTGATGTCTTCCTTCTAAACTAGCGT
GATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATTCTCGTTGACCCTCTTCGTAGGGGGGCAATAGAA
GAGCAAGTCATTCAGATCCACTGCATAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACACCCCCCATCAGATACTTC
TTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCGCCCAATGCGGACTCCCTTCACAAATGCTTCATCGAGAATCTGGGGGCTGGATC
CAATCCTTCCTCGGGACCTAGTGACAGCCATTACCTGGACTGTCCTTTTCCCGGATCCAACCACCACCACCTCATCTAGTCGGTTCAACGTAACGAAATC
ATGATGCTCGGCCTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGC
ACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAGCAGCGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTC
TGATCACCAAGTTTGAATCTCCACATATCACCAGACTTTTTGGATCCTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGTTATACTCCGCTTCATT
GACGGTGAGGCCTTCCGCATAAGTGGATCTGGCTCTTACACTTCCCATCCGGCAGTTTCCACAGTATTGCGCTGTATACCCCTCCTTCGCGTCGTACGCG
AGCGGATCCATCGAAACTAAGTACGTACAGATCCTCATCCACTTGTACCGTTGGGATCGGGATCTGGATCCGGCGTTTGGGTTCTTTCCTAGGAGCGATC
CTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTCCACAATCTTCAGTG
TCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTTCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAAGATCCGGAT
GGCCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAATTCAACTCATTCGGCTTTAGCG
TTCGGCTGACGAAGGTGACCGGATGGCAGATCCCCTCATGTTCTTGTACCAAACCTGCTGAGACCGCCCAATCACTAGCATAGACTATCACCGTAGGTTG
AAGTCCCGGATCGAAATGGCGGAGGATGGACGTCGTCGCGATCCTATTCCTTAGCTCCACGAACGCGTGCTGAGCTCGGATCCACCGAGATTCTGCCTTT
TCCATGTTCTGATCTGTCGTCTCTATCCAGACTGGATCCTCTTTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTAC
CACTTGGATTCCTTCGTGGATCCGACATTTTCGGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCT
CAATACATATAATACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGT
GGGAAGGACAAGTCTGCCAACGAAGACAGGTCCTTAGGATTCGTCTCCAACCCCTCCTTGGAGACTCGATGACCTAAGTAATCCACTTTGCGCATCCCCC
AATAGCTTTTCACCACGTGATAGAGAGATTCCACTTAGTACACACCTCCAGTAGGGATGTCACTCTCTCGCACAGCTGATCCCACGATTCCACCGGGATT
AAAATGTCCTCGATATAGGATCTGCGTCCTAACACGGATGAAGTTCCCAGATCACCTGGCTCTCTGCTTCAAATGGATCCACTTCCGTATGACCTTCCCC
GGATCCACCTATTTCGGGTTCCGGTATTCGGGTTAATCCGTAGAGGGCATTATCGATTAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGC
ATCCGGCTCCATTCAAACAGTCCAAATGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAATCACTGGCCATGTCAA
GAGAACAGTACCAGAGTACTTTATCCAGATCGTCCAATAGCTCATTGATTAGCGGCATCGGATACACCATCAATCGGGTCAGGCCGTTAACTAGCCGGTA
ATCAATGCACAGACGTATATCCGCACCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAAAAACTGATGATCTTGGCTTGCAGC
AGGCCCTTGATCAGATCCGATAATTTTTCTCGGAACTGAGGTGCCACTTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATT
TGACTCCGCGGGCAGCAGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCGTCTGACGTAACCGATCCACTTCCGCGGGCTT
GTTCGCCCCTGGATCCACTTGGATATCATCCATTCGTGGACTTCCTCTGTGGTCAGTGGTACTTTCGGGATCACCGCCAGGCCTTCTCCGAGATCCTCGG
CGTGTAGATCCCCGCCTTCAAGGTAACAGACTTGTTCATCTTCCATCTTCATCGGATCCATCATTGGATCCAAGCACCGCGACCCTGTTTCACCTGTCAG
TCCTTCTGTTTTCGTGGGATCAGGTACCCTGGTACCGGGGGAGTCACCTGTTGGATCGGCTTGATCCTCTAGCGAGTTTAAACGCGACGGTTCTTGTTTG
ACTAGCGTTGCCACTCTCAACAAGGATCCAGGCACTTTGTCCCATGAAAAGCTAGGATCCACTAGTGGGTTAGCAGGATCTGGCGACCCGGCTTCCCCTC
TCTGCGATCCTCCGTCCACCGACCCTGAATTATCTAGAAACCGGCGCTGGGGATCATCTCCGGTCTTGGATCCAACCTCTACCGCTTGGATCTCAATCCG
ACGATCCCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCCGTTGGCTCCGCCGGGAGCTCCCTCGCCCCGAGAGATTCG
ATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGGGATCCCACCGACACATACCCAGGTCGCCTAGGGATACCGTCCTTCGCCA
ACCATCGTCCGATCTCCTCATAATGATCCTGTAATAGTCTCTTGTCGCTGACGTTCGTGACTTGGAGGTATTGTGACCGACCTGGTCCTTGGATTACCGT
AGGCACCCATTTCTCGCCCCGCGTGACCCACAGTTTCTCATTTTCCACCCACCTCAACCGATCTGGCAGTTCCCAGGTCTCTCCGGACTCGATCCAGGTC
GTCTTATCCGCCCTTATGATCCGTATCTTCGCCCCGTACAACGGTCGCCGTCCGCTTAGCTGGATCCGCATCTCGTCGGGGAAACACAGTGTCCCATCCG
CCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGTACACCAA
ACAACCTGCCAACGTGATCTTGATCCGCGTTCTCCCGTTAGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGG
CACCCATCCTTACGACCAAAGGCGGTATCCAGTATAGACACCTTGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTAATCTTGCCCCCTACCT
TGGCTTGTCTGAACCACTTTCCTGGTGCATGGTACTTCCAGTATCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGA
TCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGTCGCTTCTCCCAGTAATCACGTGCC
TCATCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGAT
CACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTTGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTAC
CGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAAGATCCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGT
TGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGGTGACCTTTCTTGCCACA
CTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCACTGCGAACACCTGATTTGCGCTGTCCCGTCCATGAGATCTCGG
GATCTGTACATCCCACGGTCCTTGGGTACGGTATCCACCGATAGAGAGTTGTCTCCGGTCTTCGCCGTACGATCGTTGGACGCAGTGAGACAGACTCGAC
GGTAATCTTCTGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGATCCTGAGTCGGGAGCCGTGACTTGGTGGACACGTCGAGCTGGAGCCGTAGGCGT
CGGAGACTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCACGATCCACAGCCCGCGGCACTTCTTCAAGCTCATCTGCG
TCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCCCCCAACGTCTCGATGAAATGATCCAAATGTTCCCGTAGTACCTTGGATCCCCCAT
CCTTGATCTTCAAATTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCG
TGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCATTTC
CTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCAGTCGACGCTTGATCTCTCATGATAGCCGACTTGACTTTGCTGATCCATGTTC
GCGCTCGGCCCTCATCTTGAGCCTTGCCCGTGAACTCCATCAGATCCGATATGGCTGA