Description :
From Genome Similarity Track
Location :
Scaffold_98:2- 6544
Sequence
6542 bases(100 bases per row)
AGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCGGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGCA
GTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATACACCTGTACCGTCGG
GATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACT
CCCAAGATCTCGTCTTCCCCTTTCGAACAATTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCG
ACTTGAACAGCCAAGCTAGCGCAGAGTGTCGAGTCAGGAGCCGGATAGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAG
TATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTAACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAGA
GCTGCTGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGCTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCA
GTTCCACGAATGCGTGTTGAGCTCGGATCCACCGATATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTC
CCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGTGTCGTACCACTTGGATTTCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGCATT
TTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGT
AGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTCACGAAGACAGGTCCTAAGGACTCGCCTCCAATCC
CTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGT
AGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAAAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGAT
CCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTT
ATCGATCAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTTCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCG
CGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGCCATATCTAGTGAACAGTACCAGAGTACTTTATCCAAATCCTCCAATAGCTCATTGATTA
GAGGCATTGGATACACCATCAGTCGGGTCAGGCCGTTAACCATCCGGTAATCAATACACAGACGTATATCCACTCCGTTCTTCTTAACGATGATAACCAC
CTGAGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGGGCCACCTTC
CGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCATATTTGACTCCGCGGGCAGCGGGCAGTAATGCATTACCTTTACCAATCAGCAGAT
GTCGGCTTTCCCAGATTTTCTGACGTAACCGATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGGATATCGTCAATCGTGACCTCCTCTGTGGT
TAGTGGTACCTCCGGGATTACCGCCAGGCCTTCTCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTA
GGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATCAGGTACCCTGGTATCAGGGAAACCACCAGTTG
GATCTAGTCGGTCCTCTAACGAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGAAAGCTT
GGATCCACTTGTGGATCAGCGGGATCCGGCTCTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGAT
CGTCCCCCGTCGTGGATCCCACCTCCATTGCTTGGATCTCGACCCGTCGATCCCTCTGCCGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAA
GGGGCCAGTTGGCTCCGCCGAGAGCTCCACTTCTCTGAGGGATTGGATCTCGGTAGTCGCCTCGTACGACTAGATCTGCCATTCTTGTAAACGGGCGGAT
ACCTACTGACACCATATCGCAGTCGCCTAGGCATACCGTGCCTATCTCTTAACCATCGACCCGATCTCCTCATAGTGGTGCCAGTAATAGTCTCTTGTCG
CTAAAGTTCGTGACCTGGAGGTATTGTGACCGACCTGGTCCCTGGATTACGGTCGGTACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCA
CCCACTTTAACCGATCTGGCAGTTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTGGCCCCGTACAACGGTCG
CCGTCCGCTGAGCTGGATCCGCATCTCGTCGGGGAAACAAAGTGTCCCGTCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGG
ATGGCGTCCTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGT
ACACGCCTTCACCAATCCCAACACAATCTTGAATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGC
ACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGACATGGTACTTCCAGTATCCA
CGGGACTCCCCGGTTAGCAGATCCATGGATACAACATCCTCAGATCCACGGGATCCAACGACCTGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCT
TGGTAGGCCCAAACCATCGACCATGTTGACGTTTCTCCCAATAACCACGTGCTTCTAGCCTTTGTAGATCCAGAGGTTGAAGAGACTTCGGATCTGGCAA
ACTCATCCACTTGGCGCAAACCAGAGATCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAG
CGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCA
CTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCC
ACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTC
CGGGATCCGCACTGCGAGCACCCGACTTGTGCTGTCCCGTCCATGAGATCTTGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGACCGCG
AGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGATGCAGTGAGACAGACTCGACGGTAATCCTCTGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGT
TCCTGAGTCGGGCGCCGTGACTGGGTGGACACGTCGAGCTGGAGCCGTGGGCGTCGGAGCATTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTC
TGGCGGTGTTTCGCGCGATCCACAGCCCGCAACACTTCTTCAAGCTCATCTGCGTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATTTACATCTCCC
AACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTGCCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTA
GGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAG
CAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCT
AGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTAGACTTTGCTGATTCATGTTCTCGCTCGGTCCTCAT
CTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGAATCATGGACGATCCACCTGCCCCGGCTGTGGCTGCTGCTAC
CACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCTA
TGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCG
AGGAAGTGTCGGAAGCGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTT
CTTGCCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCAGAGGGCCTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGG
CTCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGCTTGAACGACGTGTCCGACTCATCCTCAGCGGCGGATTCGT
AGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCATAGAGGTCCCG
CGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGGCTCCGTAAGCAAACGTAATAGATCC
TTGACTGCCACCAACTTGTTCGCCGTTTAAGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTT
GATGCAGGAAGTCGCGTAAAGCTTGGTGGTGATACACAAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGG
AGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTTGTCTTCTTTCTCGTTTCTTCGACTAGTGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGT
GAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGG
GAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTCGTTTC
ATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAACCCCGAG
TCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGA
CTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTTCCG
AAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAA
TCCTAAGCGAATATTTGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTT
GCGTCGTACTTGCCGCCTCCTGTGATGGGATCTTGAGAGTTG