Description :
From Genome Similarity Track
Location :
Scaffold_1110:2- 6244
Transcript NameFunction/comments
g16006.t1XP_009536588.1 hypothetical protein PHYSODRAFT_340195 [Phytophthora sojae

Sequence
6242 bases(100 bases per row)
CCTCCATCAGGACATTTCCGGGATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGA
ACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGCGGGTAGA
CGCCCCGGGTTTGGTCAACCAAACTTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGT
TGAAGGCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGACCTTTACGTTCGAGGTCGGGACGAGACTCTCTGGCGTCTCGAAGCGCGTCGCCGCGCTCGA
GAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTA
TGTCCAGTGTGTACGCGTTGCCATGCTTCGTCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGAAACTGCATGTTTA
GCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAATTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCGCTCAGCTTTTGTCGACCGACAG
AAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTT
GGTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTTGTCGTCATGACTGCGCGCAGGA
CGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATACCCTCCCCCACTTAAGGAAGGAGCTA
CCGCACCGAGTACGCTTGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTC
CGCCATCGGCAAACAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAACACGCGGTTGGCACGCTCTGTTTGTCCGTCGGTC
TGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAAAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGA
TGTCGAGTTGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAA
GCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCTGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTC
GGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGCTGAC
TCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCATACGTGATCTTGAGCTTCAG
CTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGGCCGTTGTGTACACGATAACGGTGTACACGGGCACGA
AGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAATACTCCACCAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTT
CGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATATTCTGGTCGACGCGAAAGCGCGTC
GGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGAC
TTGACCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAA
GGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGGCGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCAT
CAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACCACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGCCAAGCCCTGC
TTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCT
CACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGG
GTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTC
GCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCAATTCACAGCCCGGCTGTGAATGAACACGTCGTCAAAATAGCT
CGGTGCGCGACTTCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAG
AGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGGGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAG
TACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGATATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCG
CCACCCGCCCTGTGGTTTCTTCACACAGAACGCAGGCGCGCCGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCG
TCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCATGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCT
GCGGTAGCTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCCAGACCTTGTAAAAGGGGCTCGCCTTAAGCGAGTCCCAGCCTTGCTCGTC
GAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGTCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCACCCTCTCGACGTCCGAG
AGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAG
GATTATTCAGCCTCATCTTCTTGTATTGAAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGC
AGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTGATCGCTTACGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCT
TCTTGTCCAGGCCCGGCCGTGGACAGTCGTTCCTTGTATTCGCCGGCGGGTTCAACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTT
CGTCGTGCAGCCCGGCCGCACGCGAGCTCGCAAGCATCTCCGGTGCAGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGC
GTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTAGCTGTCGACACTACCGCGTCGCTCCGGACGCTTCGAGTC
CCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATATTTTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAG
CCGCGTTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAA
GCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACAACATATCGAACTTATCGTCCAGTTCCAGGACG
ATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCTA
ATAGACTTCGAGGTGTTTCTACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAG
AGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGTTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTC
ATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGGCGATACCC
GGTATCGCCACGACGGCTTCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGAT
CCACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGTTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGTGGGG
CGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGT
CTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTTTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTT
TGGGCGTAAGCATGTACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCT
CCTCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAA
CGCAACCTTCGACAACGGTTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAG
CTGCTTACGTGGAGTTTTAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGCAACCCA
GAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATAGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTC
TGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGTGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCC
CCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCATTACTTAAGCTTA
CACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCTGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAAAGAACCAAAC
GGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGAAAAAGGGGGTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCA
GAACCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACC
TGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG