Description :
From Genome Similarity Track
Location :
Scaffold_658:2- 6022
Sequence
6020 bases(100 bases per row)
ACGTAAGACAGAGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATCTAGTACACAAACTACCTTCCTTTTTTGGTTATGAGCCCAAGCCCCGCAG
ACTCTGCCCAAGACTACGCCTACGCCATGGACGCCACTTCAACGACCGCCCGCATCAACAAGTTCGACGGAACCAACTTTCACACGTGGAAGTTCAAGAT
GCAGATGGTGCTGGAAGAGCGCGACCTGTGGGAAGTCGTGTGGTGTAGTGATTTCTCCGTGGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGC
CCAAGTTGTTCAAGCGACGAACCCTCGGTCGGGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACCTCCGAGTTTTCAACAAATATTG
GATACGGCCATATGTCACTGAATCCAGGCTGTCCTTATTATTAATAATGGACTGGCTGGATTCGCATTCAGCGGACCATCTACGGTACGAACCCTCAGTG
GCGGTTGGGATGAGTTCGCGGAATACTCAGCGACCTTTGGAAGACACGTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATGCTCATGCGACAGTGC
AGACGACGCTTGGCATGCAAGAAGATCCATAACGGATCATTGTTCACTTGATATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGT
TAAGCTTAAATACAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAGGGTAGGCGTCAGGTCAAGCTGTGTTTGAGTGTGTATATGGC
CTGTTGCGTGAAACTGGAGATGTCGTTAGGCGAGGGATTTCTTTCGGGCAAGGCCAAGAGAACTTGTGTATATTGGCCAATTATTATGGGGAGGTTTTAC
GTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTTAATTGCCTCCCTTTTATTTCTTCCAGCCGAGTGTTGAACACTCGGTGATCTCGTAAA
AGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGTACCACGAGGATTCAAAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTAATTTTACTG
GTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTAGTA
GACGTATTGTTGTGGGAACATCCTAACTACATTTGTAGCTAGAGTTCACGTGGGAATTCCAACACCACAACTGGTGCCGCGACCCGGGAACAGATTGTGA
TCATTGTGAACTGTTTGTATGGCCTTCCAGTTTACGAGCTACCAAGAGAAGAAGAACAAGAAAAAGACAAGAAACATGGCGAAAGGACAACCGACGGTAC
CAGTTACGCCTGCCAAGTCTGGCGGGGCTCGCAACGAGAGTTCAAGCCCGGCTGCGCGCTTTGCAGCCGCCACCGAGCTTTCAGTGAGCTTCGACGACGA
AGCGGACATCGGTCCTGACGCCCACGATTATGAAGATTACGAAGATAAGAATCCGGCTCCAGAGCCAGGCGCAGCGACGCCGGAGACGGCCACGCTATCA
TCGGGGCTGAGCGGGGCGACCAAGTCCCTTTCGAGGAACCTCGCCGACGAGCTCGATGATGTTGCGGGACCGGAACCGGCCTATGATGAATATGACGATG
GGACCGAGGGTTTTAAACCTTCGGTGGCGAGTGCAAAGCATTCAGCACTGCTGAAGGCACCTCGCCCACCTATCAACGGTGATACACCAGCCGCCAAGCG
CGTTTTCGACCGCGTACAAGCGCTGATGCAGAATGATGAGTGGATGCAGCTGTTCAAGCCCATCCCCAAGAAAAAGGCCGACTGGCCTGCGCTTGCGCAG
GAACTTCAATACCCAGTCAACTCGGTTTCGACTAGTCAAGTTGCCGAGGATTCAGTTTCGCTACTGTTGTCGCTGGGGTTCGAGAACGAGACGTACCCAT
CGACGATGTCGCTCCAGGATTGGAGTCCACATGAAGCCGGAGCTGCTCTCCAGAAATGGAAGAAGAAGCTTCGGAAGGCGTTTGGCGCCGTTGGCATCAA
TGCCGGAAAGCAGCCTGTGAGTCGACCGATGATTCAAGATGAAGATCCGTCTAAGATTCCACTGCCGCCGACGCCCCAACGACTCGTTCGTACTCCTCCG
ACCAAGCGTGGAGCTGAGCGTGGTGCCTTTGGCACTACCGAAGCTTCACCGTACTTTCAAGACTCGCACATGGTTACGCCACGTTCGGAGAGCCGTATGC
AACGTATTTACGCAAGTAACGAGGGTTCGTTCGGGTCGCCGAGGCGGTGCGCGAGCTCCCAAAAGTGGTGCCGGACGTCGTCAAGTCGACAGCGATGGGT
TCGTCCAGTGACGATGACATTTTGGTGCGTACATTCGCCGAGGAAGATCCTCAACTCGAGTTGATGCGTCAGATGAATGAGCTAGCGACGCTGAATCGAC
TGGGACCCGACCCAGAGGATTGAAATGAATTCCTCACCGGCCTCATGGGATCGGATACAGGCCAGCTCCCAGGGTCTCGCCACTCATACTCACAAATCGA
AATGGCAGCGCCCTCCGGGGGACAAGCAGAGAAAAGAGACTGGAGAAACAAACACGATATAGCGCTATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACGT
ACTGTGGGTTCGTCGAACGACAAGCTATCCCGTCAGTGACGAGGTTTCGACGTGGACGGCCTCAGAGCATTCGATTGACCAACGTGTCTGATCGAACTGT
GTACCTACCAGCACACGACTCGATCGCGATGTGGATTCCAGATGGGGATTTGCCACGAGGTGACGGCTATGTGCGTCTGGAGTCCAAGAAGTACCAAGAC
TGGCAAGTATTGGCCTACGAAGGTTGTAGAGACCGCGAGCTCTTTCAGCGTGAATGCGAAATCTACGAACAATGGCTTGCCACTCAGCCTTCGGCAGTTG
GTCGACCAGACTACCCAGAACCCAGTGGAGTGCTACCACGACCTCTAGAAGACTCGCTAGTGGATTCTAGTGATCGTCTGACATGTGCAGAGCGCTGGGC
ACTGATCCTGGAAGAACGTGAACAAGTGGAAGCCTGTCTGGCGTCTGGGGTGACAGCCGGGGATTCGGCCGACGGTCAGCCTTCCGCAGAACCTTTGGAC
ACGTACACGACAACCCATGGCGGAGGCAATAACGCGAACGAAGCCTCGGTAGTGCGTACACACGAACTACTGAGACCGGTGAACGTGGTACATACGCCAA
CGAGTGGTAGTGTCCAGTCAGGGGTGACCACGGAAGCGACAAGCAACGGCACTGGATTGAATGGAGTCACCCGTTTTGACGAAGCTGTCCCGGCCTTGTG
TGTCACCAAATCTGCGAACGAGCCACCGGTGGTTGATCCAGAGGATACAGGCATCGCGCAGAAGGTGTTGAGTACGGCACCGAGTATTCATTGCAAGATT
GGTGCGAATTCCGAAATGTCAAGACAGCGGCAGAACGAGGAGCGGAACAAAAGTCAACAACTCAATATGTCGGCGGCCCACGCATTCAATATTGCGAACG
ACGACTCGGCAGGTGGTCCAGAGATGGGAAACCAGGATGGGAAGGAGATGGACCAAGTACCGACTGTTGAAATCAAAGCGGATGCCAATGTTGAGTCAAG
GGAAGAATCCGTAGCGGCGTTGGACGGAACATACATCTCGGTTGCTCGAGTGTTAACAACCGAGGGAAATGAAGCAACGGAGGATACGAGAAATGATTTC
TACGAACACCAAGCTAACAACATTGGCTTGGACGACTACGCGAAGGAGCTGGCATTCCTGCCGGACCTGACCGAAGAGATCAACACGACAATTGACTACA
CTGCGCCTAATGTTGCTGATCCTGAGCTGTCGACTGAACGCCGAGAACGTCTAGTCGCGACGCTAAAGAACCACGAGCACATCCTGATTGCTAGTGGTAA
CGCACTGCCGCCGCCAGCCTACGGAGCGGTATGCGATATCGACACACAGGGGCACGCCCCAATTAAACAGCGTGCCCGGCGCGTGCCGCTGCGATTTCTC
GGCAAGCTGTACGAGCTGCT