Description :
From Genome Similarity Track
Location :
Scaffold_1914:2- 6016
Transcript NameFunction/comments
Phyta_totarag13857hypothetical protein PHYSODRAFT_341852
Phyta_totarag13858hypothetical protein

Sequence
6014 bases(100 bases per row)
ATCCAGCCCACTGATGGatacacaaggtgaccagttcagcagatcacggatcatcgggggaccccctccgttagtcggtgtctgggcaaagttgggaagc
cggatccagtctTAGTAAGATTTTGAcggatcccgctacaccacaatggtgcgcgtgcccggatCTTTTAGTGACTCGAAATTTCACCGTGAGTCCCAAG
AAGATGTGAAGGTGAAAGAAGAACAAGGGGGTTAAGCGTTATCGAAGATCGGATCGACGACAACGCCGCCGAATAAAGCAAGATCCGCAGATCGGCAGAG
TGCTGGGAGGAACCTGTCGACAGAAATCAGGGAGATCTGGAAACAGATCTTGAAGAGAAACCTCAACCTCCTCCCCTGGTCCCTTCGGGGACCCCAGCGG
AACTCGATAAGCATCGAGACCCGCGAAACAAAACAGGGAAGGTTAAACCCGAACCGTACGCGTTCATGACGGACAACGTGACCGCAAGCCGGCTAGTCGC
AAGATCTAatacgaagaagaagaaaacgaagactacgctgaagaaaatgaaggcaTCTGAGTCGGAAGGCGAAGGTCAGAAGGAATCTCCATTTGCATGG
ACCGAGCAGGAACTAGAGTTCGCGTTTCACCACAAGGCGCTACGCAACTTCTTACTCCAAGATCCAGTgatgaagatcatgaagGTATAGCAGATCGGAG
ATATGAAGGGACCAGTGTCAGCTCCGCCAGAAATGTCCAACAAGCTGACCGTAGTCAAGAACCTACTCCAGATGCTGAAAGAGGAAGGTCTAGTCACCGG
TGCTTTCGATGCCGACGGACTGTTTAATCTAGACCTAGAGACCGTCAAATCTACTTCCCGAGAACATTTCGCTAGATTAGCGATCCTGGTAGGCGGAAAT
GCACGGATCGAAGATCCAGAGATCTCGCCCCAGAGCATCACGACGGAGTGCCAGACTGGCTCTTCACATTATGCACTAGCTACGTCAGAACCGGACGCTT
ATGGATCCATAAGGCCGCAACGCATGCCTCTCTCGGACCTTCCGGAGAAGCACTATTGATatctcgatctcgtgggAAGTCCCCGGATCGGACGCTGCCG
CAACAGCAGAGGCCGCCACAGAGGCAGCCAAACCAGATCACGAGCATAACCTCGTCGGAAGAACCAACAGGCAGGCTGGAATCGTATTTCCAAGCTGCTA
TGAGCCGATTCGTCAAGGAACAGCAATTCGTGGCACCAACCCCGGTTGCGACCACTATAAGGAGTGTTGGCGCACAAGATGTGGACATGGAGTCGGTCGG
ATCATCAGATCATCACCCCGCTCTCTGGGAGTACGACCCCGATGATCTGGATGCCCCACCCACTCGTGCCGCAGTagctacagcaacagctggATCCGCG
CTCATCCAACTTGTGCGGATCTCAGCAATCTCCGATCTGAAGGATTTCACCTGGAaagatcaagatgaagatcggGCAAGAGGGTGGATCAGCAAGGTCA
AATCCGCATTCTTGCGTGATCAGGCCTCCGATGAAGAAAAGTGTTTGACATTCGGAGATCTGTTGACGGGGCCTGCGCGGAACTGGTACCGCCAGTTGAG
CCGAACAACGCGAAATAAGTGGAGCGATCTACTCCGCATCTTCCAGACCCAATACTGTGGTCTCGGTGTCTGAGTCGTGAGGCAATACTACCATGCGCAC
AAGGGATCTGACGCGACCTCGCTGGAGTACCTCTACCGACTAAACGTAGCTGGTTTGCGAGCACGGTTGAAGGTCAAGGATGGTGGAGCGGAGGAACGCC
GAGAACGTGTCGACCATTTCATCGAGACAGTTGGAAATCAAGACCTGGCTGATCAATTGACGTTGTTGCGACTGGCAGATGCCGAAGAGCTAGATGAAGC
CCTACTTGCCCGTGAACGAGCCAAGAGTCGACTGAAGAAAACAACCTTTGGATCTAACAAATACCGACAGAAGGTAGCCGTACCGGCTtcggcagcacca
acaaagCGGGCGGTCCAAGTGAACCAAACCCAAGACTCCGAATCAGGATCTGACTCCGGATCGGACAGATCTGAGTCTGAGGGAGACTTCGACGGATTTT
TATGACATCATGAGATAACCCGCCGACGGATTCAACCCGAAGTGGCGCCGATCCAGCTCCACAAGACCGAAAATTATCAAACCGATCGCCGCGAGAACCC
AGgctgcagatccagcaggGCGGGTCGAACCGTAGCCGTTGTCCGCACTGTGGATCTCGTAAGCACACAGATCTCGGCTGCTGGAGCCGTTTGATCTGCC
AAAAGTGCGGGAAGAAGGGTCACCCGTCGGATcactgcttcttcgtgagTCGCGGATGTAAAGAACTGCATGATATGGGAAAGTGCCCGATGGAGGAGTT
CTACAATCAACTCCGTCAGTGGCACGATCCGACCAAACATGCTGGCATGCTTCCGGCTATGGCTGAGAAGATGTTAAATTAGGACGCTCGTCAGGTTGGA
ATCTGATACGAGCCAAGCGTTGTGAGGTTTGCATTTATGCAtttgtggagaagaagtcggtATATCAAGTCAGTGGACAGCAGCTAGATCTACGCGATAA
TACATGTGATTTACATGAGAACGCACAGTCATGGTTGCAAGGCTTCGTCATGTAGATGAATATGCAGATCCGACGTGATGATGTCtctggatctcctcgc
gGGCGAGTCGCGAGGTTATTGGAAGCATCACGCGCCGGGCAAGTGGTTCAGACAAGCGAAAGCAACGGGGAAGATCGACAGTGGAAAGGCGATCTTAATC
TTAGACACCGGTGCCGAGGTGTCCATATTGGACACCGCCTTTGCTCGTAAGGTTGGGTACCATGTCGACACGAGTCAGAGCCAAGATTGTGTGGGAATTC
GTGAAAGTACATATACGAGGAATGGCAAGACCCGAATCAAGAGCACGCTATCATGATCTCTGGTTTATTTCTTCGATATCTGGGTGGGTGATCTGGCAGG
CCAAGATGCTATCTTAGGCATGCAATTTCATGGTACCGGCCGGGATCCGGCTGGATCTAGCCGTTGGGTCGATCTGCTTGCCGGACGAAGTGAAGATCCA
GCTtagtggacgacgacagctccacaATGGCAAGGTGAGGTTCTTGAGGCTAGATCAGCACACGCAGATCGGCATCGAAGTATCCGTGGAGCTTCCAAGG
AGCCTCAGAACTTCCGATCAAGAATTTTTTTTGGGTCACTAGGGGAGATCGGTGGGTGCCCACGGTGGTCAACGGCCCCTGCAAGTCAAGATATCTGCAG
ATCACCAAAATCGGCGACAGGAAATTGATCCTTCAAGATGACGAGCGAATCGGGATGTGGCTGGTAGGAGATCGTGTACCACGCGTCTCAGGATTCGTCT
CTGTTGGATCCCGCCGCTAGAGGGAATGGCAAAATCTTGCCCTAGAGGCTACCACAGAGTCGAGACCGGAGGAAGGTCAAACGgtcgacgtcgttgacgG
CCCTAGTGTGCATCAGCCGGAGTACCCGACACCTCGCGCGATATTACGGAGAAATGACACTACGCCGACCCAACGTACATCGATCGGGTTGTTGAGAACC
GAGCCCAGACACCGGCGTTGCTCGGAAGCCTCCCGGTGCGAGTGGACGAGCTTTCGGGGCCGACGAGTCAGGTGATAGCAGGGGTGTCAAAACCAGATCC
AGAAGGTAATAAGCCATCGGGTCAGATCTGTTGCCGGTACACGGGGATACATCGAGCGAAGGGAATGATCGACCGCCTACCATAAGGATCACAGAGTTGC
TCCCGGAAGACGTGCCAGCGACAGACACGGATCCCAGGTTGAAGCCGACAAATCACCCGAAACAAGTTGGTCTAGATCGACGAAAAGAGTAAGGTCAGGT
TGAGGAGGAGAGGTCTGTTACCATGAAAGCGGAGATCTGTACGCCGAGGGAGTTCAAGGAGAGTTGACAGTACTCCTGGAAGTCACCCTGACTACGGATG
AAGTTACGATCGACGATATCCAAGTAGGAGATCCGGGGTTCAACTCTCTGGAAGAGATCGATTGTTTGCGGCGGAAGATCTGGAAGTATCGACATCTGCT
CATCGGCAAGGGTAATGCGTTACCTCCCGCTACCTGAGGCGTTGTATGCAACATTGATGTGGGAAACGCTTAGCCGATCGCCCAACACGTGAGGAAGGTA
GCCCCGCAGTTCCGGGAAAAGTTGTCAGAGCTGATCAAGGGACTGCTCGCCACCAGCATTATTCGCCACTCGACGTATCCCTGGGCTTCCCCCATAGTGG
TGATCATCAAGAAAAATGGGGTGGACATATGGATGTGTATCGATTATCGACTGGTGAATAGTCTCACAAGACTTATGGTGTATCTGATGCCCCTGATCAA
CGACCTCTTAGAAGACCTGGACAAGATCTTGTGGTACTGTTCGCTTTACATGGTGAGTGGGTTCTAGGTAGTGATGATGACGGATCGTGCCCGAGCAATT
TCAGCCTTCACCATGCCGTTTGGCTTATTCGAATGGAATCGGATGCCTTTCGGCCTCAAGAACGCTCCTCAGATCTaccagcacttgctgaacAATGCAC
TGTATGGGTTCACTCGGATCTCGCGATCTGATGACGATCAAAAGATCAAAGATCCGTTCGAAGCCTAAGCGCCAGAAGAACCGAGTCAACCATCGGTATT
GGGACGCAGATCCTAAATCGATGACGTCTTAGTGACTGCCCGATGGTGGGATCAGATGTGCGATCGAGTAGACGCCCTGCTGGAGACTTGTGATAAGTGG
AATCTGTCGATCAGCGTGGTCAAGAGCTTCTGGGGAAGACACAAAGTAGATTATCTGGGGCATCGGGTGTCGAGTGTCGGGCTCGAAGCCAACCCCAAGG
ACTTGGAGGCGTTGACCGGTCTACCTTTCCCGGGAACACTCCGAGCCATGCAGTCTTTTCTGGGTAGTTTGAATTACTGCAGCCGCTTCGTCGAGGACTG
CGCAATTTATGCAGTGGTGTTGTATTACGGGAAGTAGACTTTGCAGCGATGACGAAAAAGGGTAAGCGTAAACAGATCGAGAGTCAGCTACAACGCCCAA
TCCGAATCTAGACCAACCAGATCCAAAGACTAAATATCTGGAGGCGAATGGGTCCGACCCTCGAGATCGAGAGGTGTCGGCGGTAGACGAAATCGACCAA
CGATGGATCCACGCTCACAGAGCTTTTGTGATCCTAAATGAAATCGCGAAGACGCCAATCTTACGGCACTTTGACCTGAAACGTCAAGCAGTGGTGGTCG
TGTACGCCAGTCACTGGGCGATCTCGGCTGCTCTGATGCAGGATCACGATAGGACGCATTATCCTGTCATCTTTGCAAGTCGAACCCTGAAGTCGAATGA
GTTGAATTGCGGAGTGGTAGAGAAAGACGTGCTGGCCCTGCTGCGGATCTTTGATATGAATATAATGTGCTGGTGGGACGGCCAATCCGGATCTTGACCC
GATATTCGGCGTTAGCGTGGCTCTTCTAGTCTCCTTGACTTCAGGGACGATTAGGGCAATAGGTAGCACTGCTGTCGCCGTGGACACTCGAGATCACGAA
GTGTACGAAAGGGGAGGACGAGATCCTGGGGGCTGGCTGCCTGCATAACTCCTAGATCTGACGTGGATAAGGCCCTGATCTCGATCGCGCCGAAAAAGGA
ACCCCGCCGTCAGATCGAAGCCCCGATCCCTACCGTGAGAAGGGAGGAAGAACTCCTCGTAGCGAGCTTCGACGGATCGGGTCGGGTCAAGTGAGGTGGA
GGCGCGTTCAGCACAATCGTGTGAAAGCTGCCGGATTGGACGGTGGTCAAGGTCAAATCTCTCTATACTGAAAGTTTAACAGTGAACGAGGCAGAGTACA
ACGGCCTTCTGTTGTGTCTTGATCTACTGGACGGGGTGGAATATCAACGTCTCGTGATCTGTGGAGACTCAAATCTGGTGATCCGTCTGTGGCGatgtga
ctccgaatctcagg