Description :
From Genome Similarity Track
Location :
scaffold_1193:2- 5858
Transcript NameFunction/comments
g11143.t1 reverse transcriptase

Sequence
5856 bases(100 bases per row)
GAGTACGCGCCGAGCGCCGCCACGCCGCATGGGCGCGGTTGACCTGACGTTGGGTGGAGGAGAGCGCAAAACACGGGCCCAGCCGGTGATCGAAACCGGG
ACCTCTCGCACCCAAAGCGAGAATCTTATCACTGGGCTGGGCGTATCTCTCGCGTGGTAGTACTACCACGCGAGGAAGAGATCTGACGAGTCGCCGCTCG
AGTATCTCCATCGCCTGACCGTGTTAGGTCTCCGAGCCAAGTTGCCGATCAAGACTGGACCGCCATCCGCTCTCCGAGAACATGTGGAACACTTCATCGA
AACCTTGGACGATCGCGATCTTGTGGACCAGTTAACATTGCTGGCCTCGCAGATGGAGACGCCCTGGCAGACGTGTTGCGCTTGCGTCAGCGTGCGAAAG
CCCGACAAGGCAAAGCAGCCGCTGGATGAACCAAGTACCGCCAGAAGGCCCCCTCGGCGCCTCCGCAAGCCTCGTCCAGACATGCTCGAGCCGTGGGTGC
GATTCGCATGACGAGCGACAGCGACAGTTCGGAATCGGAGTCAGAGTCAGGAGGATCGGACTTGGATCAAGGCCGATCTCAGGTCTACCTTGCTGCTGTC
GTGGACCAACGGAAGCCGGAAGATCAACCTCAGCAACGCCGTGATCCTCAAGGACCGCTGAGCAAACCGGATCAGCCCCCTCGCCCCCGGAATGAAGATC
GCGTGGAGAAGTGTTCCCACTGTGGGTCCACGAGACACTCCGATCTTGGGTGCTGGATACGCTTGACTTGTCAGAAGTGTGGCAGAAGGGGCCATCCTGG
AGATCTCTGTTTGTACGTTTGCCGAGCGTGCGGTGAAGTTGACGAGGCCGGCGAATGCCCGGTGGAAGAGTTTTACAACTTGATCCGCCAATGGTACGAT
CCCACGCGTCACGCCGGGATATTCCCCTCGAAGGCGGAGAAGATGTTAAACTAGAACGCTCGCCAGGTTTGAATCTGGTACGAGCCGAGCGTTCTAAGTT
CTGCATATTTGCATACGTTGACAGGCAAGCGAAGTCGAAGGTCAGTTCTTCGAAGGATCCTATCAACAATACATACGGAATTCATGAGAAACGTACCTTC
ACGATCGCGAGCCTGCGGAGGGATAAGTATGCGCGATCGGATGTTGTGATGGAGTTGGACTTGGCTGATGGAAAGACCCGTGGATACTGGAAGGATCATG
CTCCGGATACGAAGCCCGGAGAACTCATAGCCGTGAACTCGTTGACGAGGACCCCGCCGGACCTCGGCTGGGACCTCAGACCGGGTGAATCGCGAGGATA
CTGGAAGTATTACTCGCCCGGCAAGTGGTTCAAGCAGGCGAAGATCACCGGGACGATCAACAACTCGAAGGTGACAATGCTGTTGGACTCTGGCGCAGAA
GTCTCAATCGCGGATACCACCTTTGCTCGTAAGGTTGGCTGTATCATAGACGAAAGTCAGAGACAAGAATGTGTTGGAATCGGAGAGAACGTGTATACGA
CCTTGGGACGTACCACGATCAAGGTCACGCTGGCTGGATACTTGGTCTACTTCTTCGACGCCTGTGTTGGTGCCTTGGCTGGCAGGACGCGATCTTGGGC
ATGGACTTCATGGTCCCTGCCGGGATCCGGCTAGATCTCGCGGACGGTACGATGTGCTTGGCCGACGAGGTCCAAATTCAGCTGTCGGGACGACGCCTGC
CGTACGGCCGAAGCAGGCACTCGCTATTGCTGGAAGATGACGTCGCGATTCCCGTCGCAGGATCTGCCGAAGTTCCCCTGAAACCACCACGCGCGTTCGA
GCGAGAGAAGTTGTGGATCGTGCGTGGAGAAGAATGGGTATCTACCGTCGTGAAGGGCCTTAGGCGTCGACAACACCTGCGGATCACCAATGTCGGTGAG
CGGGAGCTCCACCTGTCGCGAAGTACCGAACTGGGGATGTGGCTGGCCGAAGATCTTGTTCCCCGTGTGCCAGATCATGTATCGTTAGGATCGCGTCGAT
ATGCGGAGTGGCAAACTCTCGCGTTCGAAGCGACCACTGATCGGCAGGAACAAGAAGAGCCGCCGCCCGAGTCCTCCGAACCCTTGGTGGATCACCCTCA
GTACGACCCTCCGACGAAGGTGAAACGTTACCCCGACCAGTGGTCGCAACGACGTCCGTACGTTGGGCCGGACCTTTGGTGACCAACGAAGAGACCCCAG
AAGTCAAACTGGACTCGAGGGAAGAAACCGCAATCCGAAGTGATCCAGAGATCGCGAAGAAGGAAGGCGGTGCCGAACCGGAAGCTGACCTCACCTTGGA
CCACGAAGAGACGGTGACCGTTCTAGTCGACGACGTCGCTACGGAAGAACCCCAGGAAGAACCGAAGGGTGACGCCTCGGAAGAACCCGCCGAGATTCGG
GAGGATGCCGAAGGGTATTACCACGATGGTGGGAGCCACGTTGCGGAAGATCTTGAGGGACAGATGGCTGTCCTGCCCGAGATCGTGAACACGACCGAGG
AAGTCAAGATCGAAGACATTCGGGCTGGAGATCCCCAGTGGAACACTCCGGAGGAGATCAATCGTTTGAGACGCATCATCTGGAGGCGGAACCATCTTCT
GATCGGGAAGGGGAACGCCTTGCCACCAGCAGCAGTTAGAGTAGTTTGCGACATCGACGTGGGAGGTGCGGCCCCGATCGTGCAGCGCGTTCGCCGGGTA
GCCCCACAGTATCGCGAGAAACTCTCCGACCTCATCAAGGGTCTGTTGGCTGCGAAGATCATCGTCCCCTCCACGTATCAGTGGGCATCTCCAATCGTGA
TCATCATCAAGAAGAACGGGGTGGACATCCGGCTCTGCATCGATTACCGCCTTGTGAACTCGCTCACCAGATTGATGGTGTACCCCATGCCGTTGATCAA
CGATCTTCTCGAAGATTTTGACAAAGTTCTCTGGTACTGTTCCTTGGACATGGCGAGCGGATTCTGGGTAGTCCAGATGACGCACGCGCGCGGAAGATCT
CGGCGTTCATTACTCTCTTCGGATTGTTCGAGTGGACCCGCATGCCGTTTGGATTGAAGAACGCGCCGCAGATCTACCAGCGGTTGCTGGACAATGCCCT
GTGTGGATTCCTCCGGATCGGCAACGGCAATGGCCATGAAGATCATGCTGACGTGTTCGAGTCAGGCGAGCCGGAGATTGACTACAAGCCTTCGGTACTG
GGACGGCGGTCGTACATTGACGACATCCTGGTCACTGCGGACTCGTGGGACAACCTATGCGAGAAGGTCGAGAAGCTGCTCGACGCCTGCGATCGCTGGA
ACTTGTTTATCAATGTGGTCAAGAGTTCTTGGGGCATGCGCAAGGTGGACTATCTGGGTCACCGGGTCTCGATCGAAGGACTTGAGGCGCGGTTCAAGGA
TTTAGAGTTGTTGTGCAACTTGCCGTTCCCGCAGACACTGCGCGCGATGCAGTCGTTCCTCGGTAGCCTGAATTACTACAGCCGCACCATTGAGGACTTC
GCAGCGTATGCCGCGATGTTGTACGAGCTGCGTGAGACGGACTTCTTCGAGCTTCGCCGCCGAAGCAGGATCACGGCCATCCGCTGCAGACAGGGGATGT
CGACCAAGTGGAGAACGAAGAGGACCGCTGGACGAGAGCCGCCGTAGCGTTCACCATGCTGAAGGCGAAAATCGTGTCAACCCCGATCCTGAAGCACTTT
GATTCCGATCGCTCCCCAGTGATCGTGGTCTACGCGAACAAGTGGGCTATCTCCGCGGCTCTCATGCGAGAACATGATGGCGTGTTCTGGCCAGTGACCT
TCACCAGTCGAATCTTGAAGGCGAACGAACTCAATTACGGGATCGTCGAGAAGGAGGTCTTGGCCTTGCTGCGGATCTTGGACGTCTGCCACACCATGCT
GGTCACCAAGCCGATTAAGGTGCTGTCGCGATACTCGACACTGGGTTGGCTGCTTCGATCGTCAAACCTTCAAGATCGGTTAGGTTCATGGGCCGCACTA
TTATCCCAATGGACGTTGGAGATCGTGCGATGCAAGAAAGGCGAAGACGAGGTGTTGGGGACGCTGGCTGCGAGCATCACCCCTCGGGAAGAGGTGGACG
AGGCTCTGGTTGCAGCCGCCCCTAGGAAGCAGCCCTGGCAAGTGATCGTCGCGCCGACGCCAACAGTTGAACTGGATGAAGAGCTGATCGTCGTGAGCTT
CGACGGATCTGCCCGTGTGAAACGTGGCGGAGGAGCATACAGCGCTGTCATCTGGAAGTTGCCCGAGTGGACGGTCCTCACGGCGGCGTCCCAGTACGCG
ACCGAGATGACTGTCAACGAAGCTGAGTACCATGGATTGTTTCTGTGCCTGGATCTCCTGTCACCTTTCGACAGGGGACGCTTGGTGATCTGCGGGGATT
CCAACTTGGTGATTCGGCAGATGCGTGGCGAGATCGCATGCAAGGCGCCGGCGCTGCAGCTCCTGCGTGAGAAATCGATGGGCAAACTCTCGTCGTGTCC
TCAGCACGAGTTCGTGCACGCGAAGCGGGATTGGAACCAAAGCGCAGATCGTCTCGCCAGCGAAGCCTTACAGGCGGAAGCAGGGACGGTCGTGACGTCG
ATCGAGGTCTTCGAAGACTTGATCACCCTCAATCGGCTTGGGGAGATCCTGAAGCCGAAGAACGATGAGAGCGTAGTCCGTGTCTCCGCAGTGACTCGAT
CGTCCACACGACGGCGTGCCCCACCGGAATGCCTGCAAGAATCAGTGGTTCAAAGCATGAGGTTAGAACGCATCGCCAAAGCGCAGGCCGAGGAGCAGTG
GATCGCGGATTTGAAGACGTACCTGACCGGGAACGTGGCGGATCTGGCGGCGAAGGACGCTCGAACTTGTGTGAAGATCGCTGACTTATACGAGGTAGAT
GACGATGGAATCCTGCTTTATTGCCCAATCTCCACGCTCAAGTCGGACGAAGATCGCGATACGATCGCCAAGCTGGTGATCTTGGAATTGCTACGCCAAG
ACTTCCTGCATCACTATCATGCGAGCCTCGAAGGCGGGCATCAGGGGATCGGAAGAACTTACGCGCGGATCAAGCAACACTTCCACTGGAGGGGTCTGTT
CCGAGACGTACAGAGATACGTTGGTGAGTGTGTTGACTGCGAGACTGGGAAAGGAAGACCTACCATTCAGGGAAGACCGCCCGGGAATCTGCAGGCCACC
TACCCGTTCCAGATCATCGCTATGGATCACATCCCTTCACTTCCGAAGTCGTATAAAGGGAACACGGAGCTCTTGATCTGGGTAGACCTGTTCACCGGGT
ACGTGCTGGTGAAAGCAAGCAGCGCCCGAACCGCGCAACAGATCACCGAGAGCTATGAAGAGAGTGTCTTCCGTCGCTTTGGAGCGAGCGAAGTCATCCG
GCATGATCGCGAGCCCGGGTTCATGGCGGATGTCTTCCGGGCGTTCAATCGTATTGTGGGCCAACGGCAGAGCCTGACGATGGCTTACCGCCCTCAGGCC
AATGGAACAGCAGAACATATGGTGCAGACGCTGACTCGATCAGTCAAGATGTACGTCGCAGACATCAACCAGAAGGACTGGGACGGGTATGCAGAGCGGC
TGCCGTTCGCGCTGAACACGGCTCAAGATCGTGTTCGGGGAGATACGCCGTTCTTCCTTGTCCATGGTTGGGATCCAAGATCCACTCTGGAAGCAGCATT
GCCTGTGGGGAACACGCGTCGCCGAGATCGCGATCCACGGAGATGGTGTAACCATGTGCAGAGCCACTACCAGCGAGCTCGTGAGGAAGTGAACGAACGC
CTACGCGAAGCCATCCGCGGACGAGCTGATCATCACAACGAAGATCTTCGTCCACA