Description :
From Genome Similarity Track
Location :
Scaffold_1420:2- 5840
Transcript NameFunction/comments
Phypl_g13361hypothetical protein
Phypl_g13362hypothetical protein
Phypl_g13363hypothetical protein

Sequence
5838 bases(100 bases per row)
TCCAAAGAACCAGAAGGACTTACGGAAGTGGCTTGGCTTGGCCAATTACTTGCGCAAGTACGACTCATCTTAAGTGCGGATCTAGGCGGGAGTTTCATCC
TCGACCAAGTGTCACGTCACTGAAGCGGGTAGTCGAATCTTCGCCACCGGCCTATTTAgaccaaccagcagcgccggaattcactggcgtcggtgctgac
gGGTCTTGACTCGCCCGTTGACTTGGGACTCGACACTCGGTCTGAGTTCTCCTCCTGCGGTGATTCACTACACCACACTGCTCCACGGTCGCGGATGTGG
CTTGCCTTGGGTGCAAACTCCCCGTTTTGCCATACCAGGTGCCAGATATGCGTGTACATCAAGCCCTCGTTCTTCGGGTGCCCGCGCTCCTTGTTACACA
ACGTCATCCAGACTCTCTTCCCTTGCACGCATGGCGCTCAGTAGTAGGacgaccccccccccccNGATGCCATTGTTCAGTCGGTGCATACGCCGTTCTC
GAACACGCTGTTTGTGTGCGGCGTTCGAATTCGACACTGCGGTTGCGTCCTCTGTTGTCATCCGTTCGTCGGCAGTGTCTTGTGAAGGTGAACAGCTGTC
GCCAGCGGTATCGTCCGGCCCCACACAGTCCAAATCAGCAGTAGGGACAGCTTCGGTGGTACCTACGGCGGTATTAGACGACACATCGGGTTGTTCCGCG
TCAGCATTACCAACGATGTCAACTTTGGCGCGCGCAGAGTTGCTGTTCTCGTCAGCATTAGAagcggtggcgtcgttccCGTCAGCTTTGAACGTGTATT
CGTAAATCCAACATGTTTTACCTTCCAAAGTGGTGTTGATGTTGGTGCTCAAGAGTGGCTCTTGCCCTGGTGGTAAAACCGCTTTACCATCTGCCACTGT
ACAAatgtggcggagcaggaatCACGAATTTGCAGCACGATCCAACCTAGCCAACGGTTGCCCAGACTACCAATttacggagggggtactccgttCGTCC
GTGGGGGCTGAAGtcttctcaccttgtgtacccgttggTTGGGCGGGTTACGATCTtccggtgacggcgaagacgtctGTGCGATCTTGAGTTGAGCTTG
TGTGGACGATATTTGGGGGATTGTTGTTCACAGccgcgtggaaatcttcactTGGCCGTCGAGTGGAGCCGATCAGGGTCTTGGATGTGCCTTAATCCAC
TCGTGGGGGTGTCCTTGGGGGTTCCTTTCcgtgcttgccgcttcctgttGGCGGGATCTTTGAGTggagagaaggtggcggcctgGCCAAGTAATCCAGG
AgtcttcggcgtcttctccgtgagGGACTTGGtgccgtcttggtcgtcgggaGGGCCAATATACTTCCCAGTCCGGACTTGTGTCTTCCAAGGAAAATCT
TTCTCTGTTATGTACCTTAGCTCCTTCCTATCCTCTCCCTCTCTGGCTGCTCCCTCTCCCAGCTAACTGGCTCCCCTCTCTCAGCAAACTAGCTCCCAAC
TCAAATTTGGTGCGGGTGTACCCTAAAACTGGTACCACTCGATCTTGNGTACCCAAATGATTGTATCCTGATCGGGAGCGATCTGGGTCAACTCAGGTGT
ACCCCAAAATTGGTACGACTCAGATTCATATCTGATCCCTGGTATCTCTAGACTGAATCAGTCATGCCGGACGATCGCAAGCTGCCAATCGTCTTCCCTT
TCCCCCCAAAACGCGGCGTCTGCACTCCACTACAACCGCCCCTTGATCGAGGTCAGCCATACAGCGGTCTAGGCTCGGGTATCTTCATCCCAGGTACGAT
TTAGCCTCCGGACTCTCCTGAGCACGGTCGTCCGCTCGCGCTCTCTCATCCTCCACTCGTACGCACAGTCAGCGCTCACTGAGGCTATGGCGGAGTACTT
GGAATCGACGTGCAACATCACAACCGCCGCCTCAGCGGCCCCCAACTCTTCGGTTTCTGCTGCGACTCCGTCGCCTCGGGCGGCTTCTGGATCGCCGtct
gctcgtccgtcagctccttcagcgtATTCGACGGCGTCAGCGCCTTCGACAGCAGATCGGGTGTCGGACACAGCGACATCGACATCGTCAACGCGTCCAG
GAGCTACTCCGGCTCCGATCAGGTCGGGGTCAAGGGTGTCATCGGTCATGGCAACTAAATCGACGTCACCAGCAGTCACGTCAGAgccttcgacgacgtc
ggccaCTGCAACTGGATcgacgacaccagcagcaacttcgaGGCCTTCTGCGGCTTCAGCGGTTTCAACGGTGCGAACGTCAttcactgcagctgcagct
tctggagtCATCTCAAGGTCCGATCAGGAGCTGACTTGGTCACAGATCGAAGGTGATCCGACGTCTCATGCCATAACCCCTCCTACTGCCAGCGTAGTGG
CGCCCGTTTTGGACGCACAGACCCTCCGGACATCCATGGCCACTATCGAGGTCGCGCTGAACCACGAGACTCAGTTTCAATCTCTCCAGCACGACCATGC
GGACCTTCAGGGTTCCTACTTCGCCCTCCGTCGGCGGGTGGCCGATCTTGAACATGAGCTCGACGCTCAGCGTCACGCTGCCGCGCTATTTGTTCGCTTC
TGTCAAGAGCGCTACAACGCGGTGCGTCGGGAGTGCGAAAATCTAAatctccagctcgccgacCTTCACACCAAGCTACCTAGTCGACGCGACAGCACCA
GTGAGCTCACAGCGGTGCGGGAGCGGCTTCGTTACCAGGTGAACCTCTACGAGGACACCGTTGAAGCGTTCCACATTCAGATCGCCGATTTGGAGGCTCG
ACTATGCGACGTGCAGACTCAGGTCGGCGCGGGAGTTCCGTCAATCCCCGCGGTGGCTCAGTTAACTCAGCTGCACACTGACCtgatggcggccacggcc
gacCGAGACACGAGCAGGCGTGAACTGGCGCAATCGCGCAACACGGTCCGAACATGGAAGCGTCCCAACAAGCCTTGGAGGCTGGTGCCGAGCGGCTGCG
TCAGCAAGTGGCACTTCTCGGACATCGGGCCGGTGAGCTTCGGGACGAACTGGCTCGGCAGACCACCAGCACACAGCGGGTCCTTGACATTAGCCAGGCA
GAGCGTGACCGCCTCGTATGCCAGCTTGACAGCACCGCGCTTCAACTGGCGAAGCAAGACGCAAATCTCGCGCAGATGACGCGCGAGCGCGATCAAGCCG
CGCGAGAGGCGGTCCACGTCCGTACGTGAACTGTTTTTTTCTCCCCTCTTGTCGCCACTCACACCCTCTCTGTTGTTAATGTTGTCCCATGCTGGCCAAC
AAGTGGACTGTTCTCGTATCGCCATATCTCGCCTGGAGAAGCGGGTTAATGCGTTCCACGAGCAGGACCAAGAAGTCCAAAGACTCCGAGGCAACCTGGC
CGCGGCTCGGGCCGATCGGGCTGCAATTAGGGCGGATCGTGACCGATTGCGATCGGAGCGCAATACCATCGAGGCCCAGTTCGCGGGCCTGACTTCCCTG
TTGCGCCCTGCAGCGGCCTCGTTGTCTGGGTGCTCCTCTTCGCGAAAAAGATGCCCTCCTTCTCCCACTCATTCTGCTTCCTCAGGGTCTAGTCGAcatc
gacagcgacggcgacgcgaGTGGTGACGTCCACGCTGAAGAGGACACAGGGACCGTCGCCGATCAGCTGGAAGCCGATGACGGAAGTCATGTCGACAATC
GCGACGATCACTCCGATGACAACCCGGATGACAACCAAAGTGACGAGAACTTCGAATGGCTTTCGCTCAAAACAGGGCATCGTTGCGGCGGGCGTCCCAG
GCAGCTACCGGCGGCTCTAGCGGCTTCTCTCGGCGGCCGATCCACATTGACTCGTCTGACTCAGCCCCCAGTGATCACGCCTATGTCAGTGGACGGACCG
ATGGTAGCCGACCCGCCGATGGTAGTCGACCCCGATCTAGCTCCGTCTTCAGTCGAGGTCGGAGCGCTGCtagtggcggcggcggcgaaaACGACGGGGG
AGTCATCGAGTAGTGCGGCTCGAGTTCGGGAAACACCCTCCTTTCGGACGGGGCTTTGGATAATCTGGATACAACCTCCATTCCCCGTGAGCAATGGATT
CCTGGTTACAGGCGTCCTCGACCCTACACGTCGACCGAGGTCGCCCCATGGCCCCTGCCTACCATTCTTCGCCTCTGCGTTCGTCGCTTGACTCTGGATG
CGCTCTTTCACGAGCTAAGCCGGCCGTCAGCTTGGCTTTTTTCCTTGTGGATTCGAACCCccgcgccgtcctcctgGCATCCGGAGCTACTTACCGAAAG
AAACGTGAGGGCTTTGATCGCATCGAAACCTTGGCAAGTGCTGCGGGTGCTAGTTACGCCCCGGTCCTTTGAACTCATCGGCTGGTTTGATACCCTCGCT
CGACTGTACGCGATGTTCGAGGAGGAGTTCATCCAGCCTTTCTGGGAGGCGGCGCACTTCTTCCCGATCAGTGGCGCCTTGCAGACACGCGTCCCCTTTC
TCGCCACGTACTACGCCGGACGCAAACAACGGCGACCGCGTGACGGCGCTCGCTGGAAGTCACTGTGCAAACACATCCTGCAAGAGATCGGGCAAGGGCT
GTATGATCTCGACATTTCCCTAGACCCGTTCTTCCTCCGTCTTCTGCGCAAGACCGACCAGGGCACATGGTAGTCCGGGTTGGGGTCCCACCAACCACCG
ACCAACTTGATCTCCGCCTTGCAAGACTTAAACGTCGATGAACCGTGGTGCAACCAGTACCGCGATCGACTCACCGACCACCCGGCTGTGagcctcgagc
gcctggaCGGCAAGTTCGCGTCGGTCGCCGGCGTTCCTTGAGACGTATCTAAACATAGCCATTTCCGCGGCCGCTTCTTTTTCGCCATATACACGCGTCA
TTTCCTTGTGAGTCTGGTCAGGCTTAGACCGTCGTGGACCAGCCACCCGATCTCACACTCATCTCTCAAATAACTCCCCTTCCAACTCCCTGTGCGGCCA
CCCCACACAGGCTCCCACTCCGGTCCCCGCAACGGCCGATCCGCTACGgttcctcctcttccgccTCGTACGACTGGATCACCTCAAAGCGATTTCGGCT
GGTGGTGTTCCGCTCAAACTCCCTCAGCAGGGCGCCACAGTTCAAGTCAGCCTCATCCCCCTACGCCGGCTCGTCGTACCCCTTCCAGAACACCTGAAAC
TCCCGGTGTACTCGCCCGTACCGCGTCCTACGCCCGGATCGGACACCCGCGATCCGCTCAActtcgaactcgtcctcgtccagtACTCTCTCCCAGCTGT
CATCCGGCAGGAGTGCCTCATCAAATTCGAGTCGGTCGGATTCGTCCGTAGCGAGCGACGTCACCGACCGATCAGGGAAGACCCTGACCAGCTTCAGTTT
GGACACGTGCACGATCGGGAAAATCCTGTACTCCGTACCCTCCACCTCCAGTTGTGCAGCGTACCGAGCAACCATATCTGCACGCGGAACGGACCGTACC
ACAtgtgcgccagcttcttcgcgtagTCTTCCTTCACCCGATCCAAGAACAGCCAGACTTGTGATCCGGCCTCGATCACATGCGGCCACACCTCGTCATT
GTGCTGGTCGGCTCGGACTTGGATCGCTTCTCGAAGACGCTCGCTGACCTGTTCGCGGGCGCGCGGGTACTGCACCTGGATGTGGTACCGCCATCTGCGC
GGATCTGGGTCGCGGCGACGCGTGCTGCCTAGCGGTAGCGACGCCTCCAGTGTCGACCTCGGGTCCCAGCCATGCACCAAGTAGAACGGGGTGTCGCCAC
GAACTCGATCCTGAGCGGTGTTCAACACGAATGTGAGA