Description :
From Genome Similarity Track
Location :
Scaffold_1120:2- 5653
Sequence
5651 bases(100 bases per row)
CACGATGCAGTGGATCTAGAACTTTCGTGGGACAGTGGAGATCTATCAGACGGTTGCGAGATGATGTTGGATGAGTGGAGAGCTCAGATCCACGACGAGT
GTACACTTTCAAGTGAAGTGGATCCAAGCGACCTGGATCCTGATGAGTGTACCCATAATAGGGTAACCATAATGATTACGCCATGGATCCGGTGGATCTG
AAGATAATACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCA
GGCAGGTATAGGCTTAAATATCAATACAGACCTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAG
CTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTCGTG
CAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAA
AGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGAT
ACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTC
GGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTC
GGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACT
CGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATAA
AACAAGATCTGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGGTCTAGAAGAAAAACCTCTCTATCCTCCC
CAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCTGCTAACAAAACAAGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCAC
CGGTTAAGCCAACACTGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAATACGGGGTAGACTACGCGGAAGAAGATGCAAGCTCC
AGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAA
GATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGAGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGG
ATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCTTAGTATCCGCGACGCG
GGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATTCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTAC
GAATCCGCCGCTGAAGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGAGCGGGCGAGGAGCC
GAGGACAGGAAGTCCCTGTGAGCGCGAAAACTCGGGATCCAGTAGGCCCTACGCGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAA
GCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCG
GGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGGCTTCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATG
GATCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGCTGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGT
AGCAACAGCCACAGCCGGGGCAGGTGGACCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGAT
GAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGACCAAGCGTCGGATGCTGAGAAGTGTTTGACGTTTGCGGATCTGCTAG
CGGGGCCAGCCAGGAACTGGTATCGGCATCTGGACAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGTAGTTTCCAGACCCAGTACTGTGGATTGGG
AGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAAG
TTGAAGATCAAGGATGGGGATCCAAGGTACTGCGGGAACATGTGAATCATTTCATCGAGACGTTGGATGACGTAAATCTGGCCGACAGGCTGACCCTGTT
ACGTCTTCCCGACGCAGACGAGCTTGAAGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGC
CAAAAGGCTCCGACGCCTTCGGCCCCAGTTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACTGTTCGGACTCCGACC
CTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACTCGCGGTTGGGGGATACCGTACCCGGGGACCGTGG
GATATACAGATCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGTTACAGCCCAGGTCAGGTGTTCGCAGTGCGGATCTCGGAAGCACACT
GAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCACGGGTGTGGCGAGATTC
ACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAA
GATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAGGACATCGCTAGATCCAG
GTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATC
CGAAGTCTCTTCAACCATGGATCTACACAGAGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACTTGGTCGATGGTTTAAGCCTACCAAGGGTGAAGTC
ACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTATGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGATAGTCCGTGGGTACTGGAA
GTACCATGCCCCGGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGGAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCT
ATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACG
GGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGTCATCCTTGGGATGGA
TTTCATGGTGCCGGCCGGAGTGAGATTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTAT
GGAGCGAAGATGAGGATCATAAGGGCGGATAAGACTACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCAGTTAAAGTGGGTGGAACATGAAA
GACTGTGGGTCACTAGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATT
ATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAA
TGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTTGGAGAGGTGGAGCTCCCGGCGGAGCCAACTAGCCCCTTGGTGGATCGGCCTTCAT
ATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTT
AGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAA
GTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCTG
ATACCAGGGTACCTGATTCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGA
GCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGAACTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACG
ATTGATGATAATTAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAG
GTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGAGGAAGGTGGCGCCTCAGTT
CCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTACAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAG
AAGAACGGGGTGGATATACGTCTGTGCATAGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGG
AAGATCTGGATAAAGTACTCTGGTACTGTTCTCTTGACATGGCCAGCGGTT