Description :
From Genome Similarity Track
Location :
Scaffold_1448:2- 5491
Sequence
5489 bases(100 bases per row)
ACGCGGGCGGATCCATCGAAACTCAGGACGTACAGATCCCTCGTCTGCCTGTACCGTCGGATCGGGATCTTGAATCCGACGTTTGAGCTCTTTCTTAGGA
GCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCT
CCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAGCCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGAT
CCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAATACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGC
TTCAGTGTCCGGCTGTCGAAGGTGAATGGATGACAGATCCCCTCATGTTCTTGTTTCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATAACCG
TAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTC
TGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATTCTCTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGC
GTCGTACCACTTGGATTCCTTTGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAAATCTA
CCTCTCTCAATTCATACAACACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAA
CGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGACACTCGATGGCCTAAGTAATCCACCTTGCGC
ATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCG
CCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACGTCCGTATG
ATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAAT
CCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGG
CCATGGCAAGAGAGCAGTACCAGAGTGCTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAAC
CAGCCGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTG
GCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCACCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCACCGACATCGA
TGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTC
AGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGG
TCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAAACTTGCTCATCTCCCGTCTTCGTAGGATCAACCATTGGATCCGAACACTGCGGCCCTCTTTCGC
CTGGCAGCCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACCAACAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGCCCGACGGTTC
TGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTATCCAAGGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCT
TTAACCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGAATCGTCCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATC
TCGACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACTTCTCCGA
GGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTC
CTTCGCTAACCATCGCCCAATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGG
ATTACTGTAGGCACCCATTTCTCGCCCCGCGTAACCCACAGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCCCAGGTTTCTCCAGGCTCGA
TCCAGGTCGTCTTATCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCAGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTC
CCATCCTTTAGATCCAACCTCACTCCGGTCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAGATGTCAAACCAAT
TCACCAAACAACCTGCCAGCGTGATCTTTATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATCGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCC
CCTACCTTGGCCGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATACACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACCTCCTCAGATCC
ACGGGATCCAGTGACCTGGCAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATAACCA
CGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGG
AAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAAC
ACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTC
CTTCAGCTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGG
TCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTT
GTGGCCCGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTTGGAAGAGCCTGT
GGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGTCGGATCTGGCTCGATCG
TGGCCGGATTGTGTCAGATCACGCGTGGGGCCTACAGGATCCCCAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGTCCGCGCTTCCAGCA
TGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCAGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGATGCAGCTTGGCT
GACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCC
AGGTCTAGCTCGAAGATATCCTCTGCGTCGAACGCACCCGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCG
CCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAATCGCGTAGAGC
TTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACACTGGATCCCGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATC