Description :
From Genome Similarity Track
Location :
Scaffold_314:2- 5472
Transcript NameFunction/comments
g11335.t1hypothetical protein
g11336.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae

Sequence
5470 bases(100 bases per row)
CTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAAACTTGTCATCCTGAAGGTAAGCTCGAAGAGAGA
GAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTATTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAAGTGGAAACACCTCGA
AGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACG
AGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTAATCGACTGGACGAAGCGCATGAT
CGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCGCGTGGTGCATGCGGCCCTCCATCAGAGACAGCG
CGGAATGCGGCTGTCTCCGGTCACCCAAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAAACGAATCAGCAGGGCCTGGTTCAATCCG
ATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCAAAAGACACTCCGCCGTTAGGCGTCGAGG
TAAAGAAGGCGCGTCAGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGG
CTGCACGAAGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCGGGGC
CTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACA
AGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACAAGTATTGGTCTCCAATACAAGAAGATGAGG
CTGGATAATCCTCCGACGTTAGCGTCGGAGTTAATTTCGCTTCCAGTCACAAGCTGGAAGCGTTTCGCTTGCGACCTGCACGATGGACACATCGAGCAGA
TTTTCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAAGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAA
GGAACGCTTCGACGAGCAAGACTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCG
GAGTTACCGCAGGACAAAGGTGTTCAGCACGAGATTGATCTCGTGCCAGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCA
ATGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACA
AGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATG
CCCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATGCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGA
GCGGCATGCTATGGGGGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGA
ATTCGCACCGAGCTATTTTGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGTAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTT
GAGCTCATGCAAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCG
TACACCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTAC
TTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGACCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGG
CCTTCGAAGCAGTCAAGCAGGGCTTGGCTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGC
GATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGAGATCGTGTGGTTTACTACCAATCGCGTCATCTGAAGCCAGCTGAGCGCAATTACCCGGTA
CATGACAAAGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACGTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGT
TGCGTACGGCGATCAAGTCGCCGCGCATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAG
GTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTACAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCG
TCGTCCTTATTGGACGACGTGAAGGCCGCATACGCACATGACGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCGCACCTTCTGACAAGTCTCGTCAGA
AGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTTGACGACAACGCAGATCGCATTGTCGT
GCCGGATGATCATGATCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACG
CGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTC
CGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGT
GGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGAGCATGGTGTT
TAGACACCATCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGAC
TGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGTTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGAC
TGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGA
GCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGGTATCCGGTTAATTCGAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGT
GACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCC
GGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAG
ATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGAGGAAACACAAATGAATTTAAAATTGGTTCATTAGTTCTGTTAGC
TACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAAC
GCGTACACACTGGACATACCGTCCAGCATGCGCCTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTG
ACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGAGACGCCAGAGAGTCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCC
GCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAAGTTTGGTT
GACCAAACCCGGGGCGTCTTCCCGCCCCCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACC
AGACCCAAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGA
AATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGC
GATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCG
CTCGGTGATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTCGT
TCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGG
CACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTA
GTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAGTACAGCGCGTACAGATTCGGT
GGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGTGCGAGGCCGCAACAACAGCGGATGGAG
CAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCG