Description :
From Genome Similarity Track
Location :
Scaffold_2316:2- 5355
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2316-fgenesh-gene-0.0Nucleoporin
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_2316-abinit-gene-0.6Chromodomain protein

Sequence
5353 bases(100 bases per row)
AGCGCCAGCCAGTACAGCGGCGAGCTGGACCCGAACACGGCTATCAAGTACGTCAAGGTCGTGCCGACGGTCTCGGAAGCGCTCGTGAACGATGACACGG
CCGACATGCTTGTGCTCTTCCACAACGGTGTCGTTGAGCGCCGCACGTTCAGCACGGGTGACGTCATGGACTGCACGTGCGTGTCGGTGCGCCACTTTGA
CGCCACGCGCGTGGCAATCAGCTATTTCAGCGACAATTTCCCGGACCAGCACCTCGCGAAGGTCGAGATCGTGTCGCTGCCGTACGTGCTGGACAACTGC
TTCGCACTGCTCGTGGCTTTTGTATGCTCGTCACGCGAAGAGCGCTCGGCGCGCGTCAAGTACGCCGTGTTCCAGTTCTCGCTCGGTTCGACCAGCGAGT
CTCCCGAGCCCGAGTGGGCCTGTGTGCTCGACTACGAGCCGACGTTCACCGAGGGTGAGAACGACACGAGCCGGTACTTTAGCGTTGACTGCTTCGGGAT
CGCCCGTGGCGCGTTTTATCTCGTGTGGACCAAGGCGCTGCCGATCCAGTTCGCGTCCATCCTGCTGCCTCGCTCGGGCCAGACAACTGTGCGCTACGCG
GCGTTCTCGCTGCAGGGCGTGCACAACCGCACGGCCGTGGGCTTTGGCGCACGAGTCGAGGACAACGCCTTTGCTGGGGACGCGATTAAGGGCTCCGTGT
CGTTTGTGCTCTTGGAGGACGACAACAAGCTCGCACACGGCGGTACTGTGTGCGTTGCTACAGCGTCCAACATGCAGAAAGTGGAGGCATTGCCTGCCAC
GCGGGCGTCGGGTCTCGCGAGCGCGTCGATGGTCCACGAGAAGAGCCGCAAGCGGCTCGAAGAAGCGAGCCGGCTCACGGGCGAGACGCCCCATTTTCTG
GCCGAGAACCTCGACGTCCAGGCCTACGTGCGGCTGCTAACCACGCACTTCCACGACGACCCGTACTCGATGTCCCCGCTGCGCATCGCAAACAAGGACG
CGCTAGCGGTCGCCCAGGCGGCTGTGTCCATTGATTTCCAGATCCTCGATGCGAAGCCCTCGTCCGGTCTGAGATGGGGGAAAGAAGACACAGACGACGC
TGCCAATGGCCGATCGACAAAGGCATCTCGCACGAGCAGCAGTACTGCAAAGGGCGGTGTGGCGCTCGTGACGCCAAAGCTCGTGCGTTTCCAGCTCGAG
GAGAAGCGCACGCGACACAACGAATTTGTCGATTTCCTGCAGCGCCGATGTGCGAACGTGTGGCAGGTGATCGTCAAGTCTCCCGAGCTCAGTCGGTACC
TCACAGAGGATGAGGAGAAGCTCAACGCGGCGATCTCGCTGAGCAAGTTCCAGGGCTCGCTCTATGCCCAGAGTTCAGTTGAGGATGTGGCTTCATTGTC
TGCTGGGAGCATCCAGCGCCGCCTCACGGGCCACTTCCTGCTGCACGCGATCGAGAAGACTGTGGAGCAGCGCGGGTACCAGAAGGAGCAGCTCCGTCTC
GCTGGCTACAACGCGTTCGACATTTTCTACTGCGAGGTGAGCAAGATCACGGAGCTATTCCAGTTCCTGAGCGTCGAGGTGGCCAAGCTGGGCACGTCCA
TTGGCGAGAGCGACCCGACGTACCTGTACGCACTCTTGGAGGCTGGCTACAGTATGCTGAGTATGCTCAAACCATCGTCCGTCAGCTCTGAGGCTCCGAC
ATCAGGTGGTGCGTTCACTGCGACGGGCAGCTGGGCGTTTACGCGACCAGTGCGTGAGGTGATTGTAGACCAGATCTTGCGGCTCACGGTGCTCGTCGGG
TACTCGTCGCTGTCCAGTGAGAAGCGCATCCGCTGGGAGAACGACGAGATCTTTGAAGTGACAGACCAGATCAAAAGCCTCGGCAGCATTCTGCTGGACG
GCTACCTGCGCTTCGTGCCGCTGCTGCAGGGAGAAGAAGCCGAAGATCTGCGGAAGGAGTTAGAAGTCAGCAAGCGCTACGTGCTGAACCCGCTCGTGTA
CGTTGCGACCAACACAGCGCTGGATGCTGCCGCGCGAAGTGCTGGTGGCTTTGAACAGGACGCCGCGGGGTTTGCTGAGCGCAAGCGCAATGAACTCTTC
CTGCACTGCGTCAAGCTCGCGGAGAAGTACTCGTACTACGAAGCCATGGTCTTCCTCGTGTACACAGAGGACCAGGCAAACCTGGGTAAGCTGGACTACG
TGTCGGGCAAACTGCCCAAGAGTGCGTCGACGAAGCGCCTCGAGGCCTATTGCAAGGCCTACGACGGCTTTGCGCAGTTCCTCTTCAGCTGGTACGGCGG
TGAAGTACGCAACCCGTGGCCCGTGTCAGCCGCCTACGAGCGCAAGGCGCGCTCGACCATGCTCGCATACATGCTGGGGAACGCAAAACTCTACGGTGGC
TCGCTCCACCAGTACATGAAGGGCCACGAGACGCTCTCGAAGCACTGCTGGATGACGGCGATCTCCATCGAGCGCTACGACCAGACGGCCACACTTGCGC
TCCACGAGGCCGAGCACGAGCACACGTCGCTCTCGAAGCGCAAGAACCTTGCGAGTCTCGCCAAGATCGCGGCGCTTGCAGCGCCAAACACGTCACGCAT
TGAGGAGAACTTGCAGCAGATTCAGCGCGAGGTACGTCCTTAGATCTGCAGTCTTATGTGATTTATATGTTGGCGCCTTGATAGCTAACCGACAATTTCT
TTATACTGGATGTTATTGCCTGTACAGCTTGTCCGTGCAAAGATCCAGACAGTGCTACAGCAGCTCCCACTGGAGCTCGCCGTGGACGCCGAGCGTCCAC
TGACGCTGGACGAACTCGTCGACACGTGTCTTGAGGCTTCATCGTCCGTGTCCAAGAACGACCCGATGAGGTACATGGATCGTGTAGAGCAGCATGCTGA
TATACTGTACTAGCTTGTTATTGTTGTGCTGACTTGTCCTTGCCTTACTTTTTTTGTAGAACGAGCCTGTTCCTCATGGCGCTTGAAGCTGTCGAGAGCA
CGCAGGACACGGACGCGTTCGAATCGACACTCGCGCACGTGTGGCGCCACGGACTCTGTGAAGACGACGAGCTCTGGGAGACGCTGCTGGACGAGTACGC
CTCGGGCGTGAACGAGCAGAAGCTGGAGCTGCTGATGCGCCAGACGCTGCTCTTTGCTGCCACGACGCAGTATTTATCCGCGGCACGTCGAAAACCTGTG
AGCTTTTCGTCATCTGCTTCTGCGGCGCTGACGATCGAGTTGATTGACGACCTGATCGAGAACGAAGAGCACGAGCACTCGGTCATTTGCGTACGCAGCC
GCCAGCTCTTTGCCAAGACGCTCAACTTTGCCCTCGCGCACTAGGAAGCCTTCGCAGGATCAATGGGTTAATAGGAAGCTGGGAACCAACAGATGAGTCG
TGTTAGCTACTTATCGACACGCTCAAGCAGGAAGATAAAGAAGCAATAAACATCCAAATAAATCCAAGAAGCAGCAAAACTGAGACCACGCGAGGATGGT
TCGTTCTTCACAATATGCACAGCAGCTACGATCCACGCCGCCAGTCGATGGTGATGCAGGTGGAGCAAGTAATTATTCGTCGTCGTCGGTCGTCGCAGTG
AGCGCTGGAGAAAGCGAGATGCCCAGCTAAACAATAGAACACGGAGAGAACGGTTGGCAACCATGATCTCTTGTCAGAATGTAGGTAGATACGGTGATAT
TGTAACGATAAACTTACCACCGCCACCGACATGAGGATCACCCGGGACTCGAGCGCAGGGTTGTGCGTTGTCACCACCCAGCTGGACATGGTAACAATCA
AGCACACAGAGTATGTCAGCAGTGTGCTCCAATATCTGGCGTTGGACAGTTGCGATGGACAATAAGGAATAGTTCATACCTGTCGGCGAGGAACAGCGCG
AGCGCAGCGACAGCGAGCACCACGAGGGTCGCTTTGGAGTTTTCGTGCTCGTTGTTGCGCACTAGTGCGCCAACAGCGATGAGCAGCGCCAGGTTGGCGA
TCGCAGCAGCCGAGACCGCAACGGATTGGAACTCGTCCGGGGTCGAGCCGATGAGCACAAGCAGCTCGGCCGCACACCTCCACGAGAGCGCGATGGCGAT
CCACTTAGCGGACGCGCGGTCGTCCTTCTGGTGGAAGAACAACAGCAACGCGACGATGGGCGTAAGGAACGGCAGCCACGCGCGCCACAGGTCGCCATTC
GCGTCCCGGGGAACGATCTGGCTCGCCAGCAGCGACCCAACCACAACCGCGACGCTCAGGAACGACACGATCCACCCTCGCTCCGTCATCTTGGTGATCA
TGTCGACGAAGCCGCCGCGGTTTCTGGCGCGATGCGCATGAAGAACCAGCGCCGAGCTCTCCACTTCCTCTTCCATCTGTTCAGTCACAACAGTCGTATT
AGACGACGACGACGACTCGTGCGAGTGGCCATGCGAGTGGCCATGGCCGTGCTCGTGGGAGTGGGTCTCGGTCGTCGTCGTCTCAATCGTTTGGGTCGTC
TGCGTTACGACGCGTCCGTCTTCCTCGTACGCCAGCGACACGGTCTGCGTCTCAGTCATGACTGACTTAGGCGACGCCTTCATGCGCGGCGACTTGCGCG
ACGTCGTGGCCACATCCCTCTCCACAGGAGTTGCGGTCTTGACCACGTGCGTCTGGAGAGCCTGGATCGTCGACCGTAGGAGCACGTCTGTATCTTCGTC
ACTGTGCGGTTGTAGCTGCGCCTCAGGCACGAACACGGGCTCCACGACCGGCGCTGGCTTGGTCTTGCGAGCGGGCGCCTTCTGCTGCTCCTGCGAAGCC
ACAAATTCAGCATTGCTTTCCTGGTTCTCGCTCGCGGGCTTTCGACGCACACGCGAGACCGAGTTGCTGCGACTGCGGCCGCGGCTCGGCGACTTGCTCT
CTGCGCCCGTCTTGGTGCGGTTCTTGCTGCCCTTGGGGCGTCCAGGGCTGCGGCCACGGCTCGGGCTGCGACTCCGAGACGATTTGGGTGTCGCAGAGCC
ATCACGCGTCTTCTTGTTGTCTGAACAGTACGCACACACACATCCAACACTTAGTAGCTGCTCGCATGACGCCACAAGAACTGAAGACGATAGCGGCGCA
CGCACTGTCTTCGTATTCGCGGATCACAGACGAGTAGCCGTCCGCCATGAGGTCCATTCGGCTCTCCCTGTAGACAGTCATGACACACAGTGAAGCCATC
CAGGAGCACCAAATATGAGTGACGAAAGGGTGGATTTAACTGGATGCACAGTGCCTCATAGCGCATGAATAGCAATGTGTACCACGTGTTGCTGTCTTCA
CCAAAGCCTCTCCATACCACCAGGTAGTGCACGCGGCCGCGTATGGGCTTCTT