Description :
From Genome Similarity Track
Location :
Scaffold_117:2- 5109
Sequence
5107 bases(100 bases per row)
TCCTGCGCTTGCGTCCGGTTCCAGCGCCGGATGAAGGCGCACCACGACTCCTGCAGCGAACTGTGGTCGACGCCGTCCACCGGCTTCTGGCGCAGCGCAC
GAAAACGCCGGAAGAGGTCCTTCATCTCGTCCAGAGGCTCCGGATCTTGCGCCCCGGAGATGTCATACAGCGGCCAGGGTCTCAGCGCTTCGCCCATCAC
GTGGGTGCCGCGTGCCGCTGTCGTCGCGCTCATCAGCGACGTCGCCGTCGCTGGAATCTGCTGCTGCTGCTGTTCCATCGTCCGCGCCTGTTGTCTGTTG
TTCCAGTCGTGCTGTACTTCTCCTGCGTGGCGCAGGATCTGTCTCGTCCCCGCCTCGTTCGTTCCGGTTGGCCACGATTTCCTTCTCGCTTCCCTTTTGA
TTGGTTCGTTCTCCGCCCGTCGCTTATGTTGCGTAAGTGCAACCTTAAGAGGGGGTGATGTAGTGGGCCACACCATTACATGAGTAGGTAGATTTATATT
ACAAAAGTAGGTGCAGCAGCACACGGCTAGCGTGTGCTGAACTGCCGTCATCCTATTGGCTGATAAATGGGGAGCCAGACCCATTATCAACCAATGAGGG
GTTGACGTGTATTTGAGTGGTCAGGGCAAGCTGCCCTGGACCTAAATAAAAACAGAGTTGATTTTCCTTCAGACTAAGCACTTGGTATCACTATCGTGGA
ACTTGCACGCTTCCTCTTTGTTACGTGTAAGCTAGTAACGGACCCTCTAGGCCCGTTACACTATACCTGCCTGAATTTCTACCTTTTATGTCTATAATCG
GCTAAATCTTCTACCAGGCTCGGCTGCCTGTCCTTTCTCTCCTTGCCCCATCATCCCAGCTGTATCAGCATCAGATCCACCGGATCCATGGCAAAATCAT
AGTATGGTCGCCATATTAGGGGTACACTGTCCCGGATCCAAGCCACTTTATTCCACCTTACTGCAAGTGTACACGCATCGTGGATCTAAGCCCTCCAATA
ATCCCACATCACATTACGAATATCTGCGGTCTCCATCGCTCGACAAAAATTCGAGATCCGCTGAATCCACCATCTCTATACCATGGAGCCAAGGCACTGT
GTGTGGGATCCTCAATCCCTTGGATCCGGACGTGGATCTGGAACATCTAGCGGTGGACCTTTCTTTCTCATTTGTTGTTAATACCAGATCCAGCTCCAGA
TGGTGTCCACAGCCTTTCCTCTATAGAATACCCACTCGATCCACCCGCGCATGGTATATCTCATACCCCTCGGTATAATTGGGCGAGAGTGGATCCGAGC
CTCCACTTGGTCGATCTCAGTTATACTGCCACCAACGATGTTCCTCTTGCCATTCTTCATACTCTGAGCCACTATTATCCCCCAAATCCATCGTCGATCA
CTACTTATTCCAGATCCCCACTGTCGACCCATATAGGATACGGATCCAGGTACCTCTGCCTTGGACCATTAATTAGCGTGGTCGTTCTACGTCACCTACC
TCATCTAGAGATAAAGTGTAACGGGGTTACATGGTGTGGAACACACAGGGGTACGAAGTACCCGGAGAGTTAACAAACTCTCAGTACATAAGTTGGAGAG
CTAACAAGGTTTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAAGAGATACATTTACCCCTAGGC
GGCTTGGCCGCAATAATAGTAAATAAATCACTTCTGGTTTTGAAGCATAAAAGTTAAGGTGTTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTT
GGATAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCATAAAGAGTGATACTCTCGGCCT
TCAATATACATTACATGGATCTAATCCACTTCGAGCAGTACGAATCCACGTCGAGCAATCGAGATCCACCCTAACCACCGGGCGTTATCACTAATCTGTG
ATAATGACTCCTTGTCAGATCCTATCTCTCATTTCTGAGAAAGCATTTCGCGACAGCATCGTGGATCTTGCCGCAATCCCGACACACGTAGAAACCGTGA
TCCCCGGGATGACCTTTTATTGCCACACTTCTCACAAACCAGATGTTTCCAACACCCGGCTTCCGTATGCTTCCGGGATCCGCACCGCGAGCACCGGGTT
GTTCCTGTCCCGTCAATGAGATCTCGGGATCTGTACATTCCACGATCCCCGGGTTAGGAATCAACAGTGCGGTCGTTGTCTCCAGTCTTTGCCGTACGAT
GGTTGAGAACGGTGAGACAGACTCTGCGGTAATCCTCCGGATCGGAGTCCGATCCATCATATCCAGATTCAGTTCCTGAGCGGGCGCCCTGACGTGGTGG
ACTTGTCGGGCTGGGCCGTGAGTGTCGGTGCTTTTTGGCGAGACTTGCCGGATCCGACCGCTGCCTTCTTTTGGCGGGGTTTCGCGCAATCCACTGCCCG
CAGCAGTTCTTCCAGCTCGTCGGCCTCTCGTAGCAGGGCCAACCTGTCGGCCAGATCCACATCTCCCAACGTATCGATGAAATGATCCACGTGTTCCCGT
AGCACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGAGGCAGGTATTCTAATGGGGGCTCGTCCGATCGACGGC
GAGCATGGTAGTACTGTCGCGCTACCGACACCCCCAACCTGCAATACTGCGTTTGGAATTCACGTAGAAAATTTGGCCACTTGTTCCTTATGGATCTACC
CACTGCCGATACCAGTTTCTGGCTGGCCCAGCCAGCAAGTCCGCAAATGTCAGACACTTTTCTGCATCTGACGCTTGATCTCTCATGAGGGCTGACTTGA
CTTTTCTGATCCATGTTCGCGATTGGGCTTCGTCTTGATCCATGCCCGTGAACTCCTTCAGGCTGAGATCTGTACCCTCTGGATCATAGACGATCCATTG
GTCCCGGCTGCAGCCGTTGCTACCGCCGCTGGCAAGGGGGATGGGACATCTAGATCATCTAGATCGAACTCATCATGGGTGTTGTCTTCCTCTACCGACC
CCATTTCGACGTCTCATGCTCTATGGCCATGGGACATTTGCGTTTGTGGCCTGGGGCATTCTCATACTTTGTTCGACCAGGAAACGACTCATCGCAGATT
CGGAGTGCCGTTGTAAGGTGCCTGACGAGGTGTCGGAGGACACGGTAGCTGTAGCCTGGCCTACCGTGGAGGAGGGTTTCGTGAGACGATTAACTGGAAC
CCAATCCGATGATAATCCAGCAGGGCTTCTTGCTGGATCTGGCCCGACCCTGGCTAGATGGTATCAGATCGCGGGTATGGCGCACTGGATTCCGTGTCTC
CTGTCCACGGAGCCTTGCTCGTGCTTCCAGCATTGATTCCCCGAAAGGACCTAAGGCCATGCGTCGCGGCTCGGAAGACGTATCTGATCCATCTTCGGCC
GCGGATTAAAATTTTGAGGATGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATGGTCTGCGGCTTTTCCCCGGTGATGGACTTGACTCTGACGA
AAAAGACCCACGTCGCCAATAATATGAGATCCATACCTAGCTCCAAGATATCCTCCGCATCGAACGCACCAGCCAGGATGCCCGAATCCGTAAGCAGACG
TAATAGAACCTTAGCTGCCACTAATTTGTTCGACGTCTTCGTTGGAGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGAATTCAGGATCCGCATG
ACAGGATCTTGATAGAGGAAGTCGCGTAAAGCTTGGTGGCGATATACAAACTCGAGATCCTTGCCGGACCAGCTTGACCTGGATACAGCTTGGTCTTCTT
CCAACTCTGGATCTTGCATCTTCTTCCGCGCAGGCTTAGTTGTATCAGTCTTTTTCTCATCCTTTCGACTAGCAGGCTTGGGTTTAGGTACGGTGTTAAC
TTGACCGGTGAATATACAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACGCAAGTCGGATCCTGGCACAGGTCAAGATC
CGCAGAGGCCCCGAGGGGCCCTGAGGAGGATAGAGAGGTTTCTCTGCTAGATCCGGATCCATCTTTTTTCCGTCGACAGAGTCCTCCCAGGACTTCATCG
ATCCGACCCCCGATGATGCCTCTTCTCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCAC
GCGCACCATTGTGGTGTGGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCTGACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCTCGA
TGATCCGGGATCTGCTGAACTTTTCTCACCTTGTGTAGGTGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCTGAAGCGCTCAAGTGGTGAGGCTT
GAGTGTCTTGGCGAGACGTGGGGATGGGGTGAAGCAGTAGTGGTAAGATCTTCACTCTACGTCCGTAGTTGTTTCTGGATGCCAAGCAAATAGAGCATTT
TCCGTAGCATCGGAGTAAGGCGCGCTTGTCATTCATGGCATTCACTCCACGATTGACACTAACTTGGCAACGCGACGGCGCATTTCGCAAAGGCCTCAGC
GTGTTGCTGCTGTGGTCGGGGCCCACGCAGTTCATAAAAACACTTTCTGTGGATACTACCGTGCAACTCGGTTTTTGATAGCTCGTTGCAACGTAGCCGA
CACGTACAGATGAAAGAGAGGCAATCGACAAATTGTATACTAAACTAACGAATCGCAACGGCACGAGTACAGTGCGGGCAAGCGTCCTAGGCTACATTAC
AGCTTCTGGAAGCGCTAAATATTAAGATACCTCCATTGGCTGACGACCGCGGCCGGAGAATTCGTTGTCGAGACTGCTAGCTGATGATATCGCCTCAGGG
GCGGGAGTGATAGCAAAAACGAGGAAGATGGCACCTGCACCATGGTCGAAGTCACAGCTAGCGTTTTAAGGCTCGTCTGCCGATCGAAGATTAGCTCCAA
CGGATTG