Description :
From Genome Similarity Track
Location :
Scaffold_657:2- 4810
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_657-snap-gene-0.7Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_657-snap-gene-0.4Conserved gene of unknown function

Sequence
4808 bases(100 bases per row)
GCGTCGCCGCCGCCAGCCACTCGACGCTTGGCGCCGCCGTCCGCCACCGCGTCGCCGCCGTCCGCCACCGCGACTCGGTTGACCGCCGTCGCGTCGCCGC
CGCCGATGCTCGTGCAATCTGTTTTCTCATGTAGTATCTCACCGTCCCGCGCCATCTTGGCCTTAACACGTTGTCGTAGCTTGGTGCTGTGTCTGGCCTT
GGCCTTGCTTGTGTTGGTCATGATGTCGAGCTGTGACTGCGCCTTGGCGATCATGTCAAAGCGGCGCTTGAGCACAGCGCGCGAGTCGTTGATGCTCAGC
GTCAGACCATCAGGGTCATAGACCGTCAAGAAGTTGCGCACGCCCGGGTCGATCGCGCAGACGCGTGAGGACTGCGTCTGCGCGAACGACAAGTAGCGAG
GAACGGCGATGTAGTACTCTCCCTCGCGCAGCCGCTGGAGTCGCACAGAGTGCTCGAGCTCTGGCAGCTCTCCTCTAATCTCTATCCCATCGTTCGGTCC
GAATCCGAAGAATGTTGGGTGGAACTGCACGCGGTTCTTCTCTCCATTCTCTCCGTGGACGACATGGAGCGAGGCCGAGCTAAGCTCAATGCTGTTGGAT
CGAGCGAACTTGCTCTTGAACTTCAACTTTGGGAAGGTGGTGGGTTTGTTTTGTCTGAGTAGCGCGAAGAACAGCGCCATGGACGATTTGATAGCCTTCA
TGAAATCACTCAAAGCTGATTGGAATACTTGACTGGAGACTCTGAGATGACGTCGTAGTGCTCGTTTGTTTCGAATAAATCTTGACACAGACCGCTTGTT
AGCAATTGGTCGATACTTAAATGAGAGATCAGAAAGCGTCATTTTTGTCGTGTTGGTGTCATTGTGTCGTGGCAATAGTCGTGTTGCACAATCGTCAGCC
GAGCGAGCGACGAGCTGGTTGTATATGGCTCGGTTTGTTGCGAACATTTGCTCCAGTTGTAGGCGTTGCATTTTCGTTGGATAGAGTCGTATCTTAATCA
CACTGTTGATTGGCTGTTTTTTTGCTTTGTGCCTTTTTGTTTGTTTTTCCTTGATGGTGCAGCTGGGGATGGTGCCAAGGCCGCCCACGGCTCGCAATCG
TTGAGGCACATGCCGTGCCTCAGCGGCCGAGGCCGACATTGAGGCGGTACGCCACGGTGTCGACCTCTCCGTGTTGACGAAGCTGGTGACGTCGTACCAT
GATGTTACCAGCTTTTCAACAACCTGCTGTGTCTCAGGGAGGCGTGGCCGCTCCCATGATNNNNNNNNNNCCTCCGCTGGCTGTCGACTTGTCCGACGTC
GACAACCAGCGTGGACCTGCATGATCCTAGCGCGACGGATGCGGCGAGCAGGGCGTGAGCGGCGGTCGCCTCGAGGATGAAGTGGCTTCGGCACCGCCAC
GAGGTCACCCATGCGCGGCAGCCACAGGTCTGTCGCGATTTGGCGGTTGAACCACTCTTCCGGACGAACGAGACTGTCGGTGTCGACCGCTGCGATCTGT
TCTGGTTGTGCGTCGTCAGCAATGTACTGTTCTGGTTGTGCGTCGTCAGCAATGTACTGTTCTGGTTGTGCGTCGTCATCTGTGGTCTGTTCTGGCTGTA
CAGGTGTGGCAAGCACGTCTGCACGGCGACGCTTGGTGGGGGCGGCCGGCAAGCCANNNNNNNNNNTGACCTCTCCATGTTGGCGAAGCTGGTGACGTCG
TACCATGATGTCATCAGCTTTTCAACAACCAACTGAGTCTCAGGGAGGCGTGGCCGCTCCCATGATGCCGCATGTTCACTTCTCTCCGCTGGTTGTCGAC
TTCTCCGACGTCGATAGCCAGCGCAGACTTGCTTGATCCTAGCGCGACACATGCGGCGAGCAGGGCGTGAGCGGCGGTCGNNNNNNNNNNGGGGTGGAGT
GGCTTCGACACCGCCACGAGGTCACCCATTCCCGGTAGCCACAGGTCTGTCGCGATCTGGCGGTTGAGCCATTCCTCCGGCCGGACGAGACTTTCGGTGT
CGTCGGTTGCGATCTGTTCTGGTTGTGTGTCGTCGGCTGCGATCTCTTCTGGTTGTACAGGTGTGGCAATCACGCCTGCACGGCGACGCTTGGTGGGAGC
GGCCGGCAAGCCACTCCCACATCGCCTGCCGACCATCGCGGAAATTGGAGAATGAATCGGTATGGATCGAGATCCTTGCGCTTTGGATGCTTGGGTTGCT
GCCTGATTTGCACCTAGGTGCAAACCAGGCGCGTAAAATGCGCCTCCTCCCAACCGCCGCCGACTGTAGTTAGATGCTAGCCAGGAAACGGACGCTGGAG
TTGACGGTAAGCGCACGCTGGAAGGTCTGATGATCATGGTCCTGCAGATACTAAGCGCTGGAGATGCACAGTATGTGTGCGTCGCGCTACCTACTGTGAC
ACAGTACTCGCATAGCTCACACTCTCCTTGTTCTTGGATGTCCCTCATTTGGCAGGCATGTCGAAGGAAAAGATCTATTTCCCAATCTGCTCAGCCTCGA
CGGCGACCTGTTCAGCGATATGCCGTACCTCACGTATCTCCACATGGCTGTCCACGATCGGCTCCAGGTGCTTCCATCTCTCAGTGGCGTGCCCAGCCTC
CGCAGTATCGTGTTCGCCCACATGTTTAGCCTGCTGGAAGTGCCAACCTTCAACAACGTCGCAGCGCTGCAGCGACTCGAGCTCGACTACCTCCCCAGAC
TACGGACTGTGCCCGACTTGTCCTCGCTCAAGCATATTGTCCATTTCGCCGCGTTTCGCCGCTCCGAGTTCTGCTGCAACGGGTTTCTTGGCACCTGCGA
CCTGACGCACTTGCCTTGCACCGCCAACCCAGTTCTTGACATTCCGGCCGCGAGTTGCTTGGACGACGATGTGGCTCGAGCCACAAATGGGACAAAGACT
CTGTTGGCACGGTTCCCATCGAGCACTTGCCAAGACAGCAAGTACGATCTGGTGAACGCGACTGACAATCTTCGTCGCGATGTCATCGACGTATGCGGAG
GGGTTCGTTTTCGTCAGTGCGAATACCCTAGCGGCTCCGGGCAATTTGGCATCTGTTACAACAACCGCATGCAGGTGCTCACGTGCATTATCAACCCTGA
TATCATCACCCTCCGACGAGCACAGATCGAGTTAGGCATCAATCCAGCGTGCGATCCCGCTGAAGAAGCGTGGCTCGGATGCAAATAATACCAAAAGCCT
TCGACTATCGACTATCATTCGATAAGATTCGGTGTAGACCCTGATATCGATTCCTGCGGTTCATCATCTGGCGCTGGCTGACCCTCGTTGGTCTCCACGG
ACGCCTGGTTTCTAGCGCGAATTGCGCGTCTTCGCCTCCACCATGCTTGGATAGTCGATGCGTACGCGTTGTCCCACATATCCCGCAAGACTTCGAGCCG
CTTCTGCTCTTCCAGTCGGTCTTTCATAGCGTAAAAGCGTTCACGAGTGCGCTTGGCGCGGTATGCTGTCTGCAGCTTCACTGCCGCCTGGGTCTTGTTA
TCAAACAGGCGGTGCACACGCATACCAAAGCAGTGCATGAACCGCGACCAACGGAAAAACTTGATCAGGACAACAATTGCAGCTCCAGAGCGCTCGCGGC
GAATGCGGTCACTTTCAACTTGCTTCATAATGCGCCGCGACCACATCTGAATCGAAATGGCGGCGTGGTATCGAGCGAGGCGGCGGGACCACGCTCGGAG
CTCGCTGCGTTTGTGTGCGTATCGGCGAACGCAGCGAGTAACTACCCGTGCAGCTTGCATCTCTCGAACAAACTCGGCGAATTGAACGCGGAAGACATGG
CGTTGATAGCAACGCTGGATCTGCAAACACGCGAGCGAGAACTGAGCATATCGCCGCATCCGGGTCAGCATCTTGCGGCAGTAAAAGCCTCGCCAGTGTG
CCTGGATCGTCGTGGCCGCCAGTTCTATGGTGTGAGCAGCGGCAGCACGTCTGCCTAGAACTCCGCGTCGCCAACTCTGGATTGTGGTGGCGGCAGCAAA
CTGCTCGACTGCTCTCTCCTCGGCGATGCATGCTGTCCACTGACTCCAGCTGCGGGTAACTACAGTGCGGAACCTCCTGCGAGCTCGTTGCATCATCAAG
AGAGCGCATTTCCTAGGCGACGAGCAAGAACGTCCGAGTTAGTGAGTTGACAAGACATTAGTGGTATCGAAAACTAGAAACGCACAGGCGGCAGTAGACA
CGGACACGTTCTTGACATTGTGCCCAGCAGGCCTGGCCAATCCAATGGCGAATGCGCACACGGAGAACGCGTTCGTGGTGTGCTTGAATCAATATCTGCC
ACTCACAGCGAGGTGAAAACAAGAAGCACTCTCTTCGTAGAAAGATTGAATACGCACTGCCAGCTTCTCGGCGCCAAATCTCTTGCGAAGCACAGACGAC
AGCGGCGAGTTTGCCAACTCGGCCGCACAGTGATCACGCAGATAGCTTGCCGTTGATGCAACTATAAGAGCCAAAAGTGCAGTCAGCATCGCTCATGTTC
GCAAGACCATAACACCACAATTAGGCTTACCGATCCCGTCATGAGACGACCGACGAGATGCATTCGACCGCGATTGGACGACCAAGGGAGTAGCTCCGCC
GTTACCGTGAGCCGGCCATGCTTTCCCACGCCGCCTTGGTTCTCTGGAGAAGTCTGGGAGAGCCGTAGAAGCTCGATGTCCACCGCGGCCCTCTGACAGC
AGTGTGTTTTGCGCAGGCACTGGTAGACGCATGATCACGGTTGGTTGGTTGACATCTTCCACTGTGTTTGGCCGACAGAATGCCTTCTGGCGAAGCCACA
CATTGCGG