Description :
From Genome Similarity Track
Location :
Scaffold_264:2- 4703
Transcript NameFunction/comments
Physo_144785putative polyprotein
Physo_144786hypothetical protein

Sequence
4701 bases(100 bases per row)
ATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCATGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGG
CTGTGAGCACGCCGAGCGGCATACTCTGGGAGTGGCTGGTGATGCCGCAGGGGCCGAAGAACGCCCCTCCGACCTTCAACAGGTGCGTGACGCACTTGTT
GCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCAGACGGGATGAGTGATGTTGAGATGCGCAAGGTGCAT
CTCCGGAAGCTGCTTGCGCTCATGTGCAAGCAAAAGCTCTATGCAAACCTGAAGAAGTGCATCTTCGGGGTGAGCGAGATACCCGTGCTCGGGTGTCTCG
TTGGGAAGAACGGTGTCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATTAGTGGCTGACGCCGTCGAACGTCAAGGAGCTGCGGCAGTTCCTTGGCTT
GGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGATTTGGACTGCTGAG
TGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGATGGCCGACCAAGATCGCCCATTCCAAGTTGTGTGTGACGCA
TCCAACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTGGTCTACTACCAATCGTGTCAGCTGAAGCCAGCTGAGCGCA
ACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGA
CCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCATATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGTAGAGTATAACTTCCGGGTTGAGTAT
AAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCAACGTCAATGCCATTGACGCCATGCGATCGA
GCACCCCAATGTCGTCACTGTTGGACGACGGGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGTTGGCCTATGGCTCAGCACCTTCTGACAA
TGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGGCGACGACAACGCGGAC
CGCGTTGTCGTGCCCACCTGCGACTCAGGATCATGTATGAATATCACGATGCACCGACTGCGGGGCATTCGGGCCGTGAGAAAACATACCTTCTTCTCAC
GCGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACATGTGAAGCCTGCGCCTTTCGCGCGGGCT
CCCTTGCAGTCACTGCGACTCGTCGGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTG
TGGTCTTTGCTGACCGCTTCAGCAAGATGTACCATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCTCGTCTGTTCGTTGACATGGTGCT
CAAACACCATGGCATGCCAATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTT
TCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAAC
ACTGGAGCGACTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCCGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCC
ACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAG
TGTCAGCCGCAACTACGCGCAAGAAGAACAAGAAGCACGGGTTTGTGCAGGGCACAGACGCCGATAAGAGCAAGCAGAAGAAGAACGGGTCTGTGCAGGC
CACAGACACCGCGAAGACCAACGCAGAGGCCGGGTCTACTGGTAGAAACGAGCTGAACTCGTTCAGCTCGGACGCAATCAACTTCGTGCAACGCAGACAA
GCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTCGACTGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGA
AGGATTCATTGGTTTTGTTAGTAACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCAC
AGTGTTGGCACAACATGGCAACGCCTACATGCTAGATATTCCATCTAGCATGCGCCTCCATCCAACCTTTTACGTTAGGCGGCTGATGCCATACCGGCAG
CACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAGCGGAAGCGAACCTCTGCTCCAGCGCGTGAACACGTTGGGACAAGCGCACGACGCGACC
TCCCACGTCGATAGAGATGTCCGACGCGCTCTGCGAGGCCTGATCAACTTGAGCTCTCAGGGTCGCCATCTCCTGCTTCAGAGCGGCGAACGCACGGATC
TGAAGCTGCTCCACAGCAGCGACTCGCTCCTCGAGGGTCGGGCCAAGGTCAATCCCAGGTTGATCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCG
ATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGGACCATAGTATCCCGAAAACGAACCGGCAACCGGTTCGTTTTCGTATTCGTT
GGAGAGGATTTCCGCCCCACCAAGATACATGGGAGCCATGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCGCT
GCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCGCGTGCTAAGAACTTGGCACGGAGATCCT
TGAGACTCTCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCGGTCGCTCAAGCGCACCCGCACCCGGAAGACACAACGTGCACTGATGGC
CTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGGGCATG
CTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAACGAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGCGA
GAAGAGGTCTTCTGGCTGGAGAAGTATCGGAGCTCCTGAAAGAGTCCGATATAGTAATCGCGCCTTTGACTCGTTAACGGATCAAAGTGCTGCTCCTCCG
CCACAGCATCATCGTGGATCCCGCTGCATACGTACAGCGGGATTTCATTTGGAGGCACGGTGTTGCCCACACGGTCTGCGATCTATGACGCAGACAGCAT
CCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAACTTGAAGACCCACCTTACGCGGGGAGCTTAAAGCCCCAGCAGCGGTGAGCGGAGTGTCGCTTT
CGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCACTGTCGATAGACTC
CTTGCGCTTGTTGGAAGAGGCCTCGCCCTCTCCCATCTCCACGTCATCATCCCCGTAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGACAATC
TCCGACTGGGTTGTCCCTGACGCGGCCTTTGCAGCGAGCACATCGCGCTTTGCCTGCTGGCGCTCATGGTACTGAGAAACAGAGAGCTTACCCTCTGTTG
GGGCGGCGGTCTTCTTCTGAGACGAGCTCATTGCGGAATGAGCTCGAGTTTTCTATCTCCCAATGTGAAAAATTGACGAATGGTCAATTTCCCGATTGAC
GTGCCGTGACTCGGCACGTCTAACCTTGACGGGGGGATGGTGTAACAGGGTTACACACACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGT
TTGTTAGAGGTTCGAAAGACTTTCTCGACTTTGGTGTAGACACACCAAAGGCTGCATACATTTACGATCACCACGACGGGTGGTTCACAGAGACTTAGGA
TTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCGTAGGAATGCTGCCAACCAGTCGTTGGCAGATTCCCAACTTAGAATATT
ACATTTAAAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAATATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGA
GACCCGAGTATATTTAACTCTAAGTTAAACTAGGCTACGCTTCCTCACATACACGCGCACACGTGGAAGCTAAAGTAGTGAGCAAAAGTAGGCCCATTAC
A