Description :
From Genome Similarity Track
Location :
Scaffold_1310:2- 4637
Transcript NameFunction/comments
Phypl_g13074hypothetical protein

Sequence
4635 bases(100 bases per row)
GCGAGCCGCTACTATCACGCGGCCAAGCACCCTGACGAAACACCCCTGGATTATCTGTATCGACTGAATGTCGCCGGCATGCGGGCGAAGATCCACTACT
TGGACGGCACGACTGAAGAGAAGAGGGAACACGTGGAGTTATTCATCAACACCCTGGGTccccaagagcaagagctggCATCGCGACTCACCTTGATGGA
AGTGCCTGACACCcacacgctggagaagaagctgcacgccaGACAACGTGGACTGTCGCATCAGAAGAAGACTTTGTTCGGGTCGAATAAGTTCAGGCAG
AAGgtgccagctccgccgcAGCCGGCCCGCGCAGTGCAAGTGATCTAAGCCACGCCAGACGGGTATGACTCGGGACGCGAGAGCCGATCTAGTGACGATC
CGATCTGTGACCAAGATCGGGATGACGAGGAACGGGCGCGATTGTTCGTAGCAGGTCAGACGCCGCCGGGGGAAATCGCCCGACGCGATCTGGGTCAGGA
AAACCCGGGACGGGATCGCCCCCGATGCCGCCACTGCGGCTCGCGACGTCATTCCGACGACGATTGTTGGAGTCTCCTGACGTGCCAGAAGTGTAGTGGT
CACCACCCCACCGACCGATGCCNACATAAGTGGTTAGTGAgagatcgacgacttcgaACGGTAATACATGTGAATCGACTCCGCACCGTACCGTGCAAGA
TCGCGTTGCCCAAGTCTTGGCCCTCCGGCACGAAGACGAATACGCGAGAGAGCCCCACTGGATGTGATTAACCTACAGCCCGGTGAACGTCGTGGCTATT
GGAAATACTACGCACCAGACAAATGGCATCGTCAGGCGAAGATTCAAGGAAAGCTGAACACCCGTCGTGCtgtgttgctgctcgatACAGGTGCCGAAGT
GTCCATACTGGACGCTACCTTTGCTCGTGAGGTAGGCTGCCTGATCGACACGAATGTGACACAAGACTGCGTTGGAATCCGAGATGAGACGTATCACACG
GTGGAGAGATCGAAGATCAAGGTTGCCATGGCGGGTAACTTGGTCTACTTCCTGGACCTCTGGGTCGGGGACTtggtcggccagcacgcgaTCNTCACGC
GATCTTGGGGATGAATTTCATGGTATCGGCCGGAGTACGCATCGACGCCGCGGACGGCACCGCCTGTTTACCCGACGAGGTGCGTATCCCATCGGAAGGC
GGGCGCTCTACGGCGCGAAGATGTGCCCGATCAACCTTacgtcgctcatgaagaTCGACCCGGGACGGACGCACGATGTTCGCCTCCGCCCGGACCGAAA
CGCGCCGCGGCTGTGGGTTACAAGAGGTAAAACGTGGGTCACCAGCTTCGCGAAAGGCAAGATCGGGTGACGAANACAAGAGGTAAAACGTGGGTCACCA
GCTTCGTAAAAGACAAGATCGGGAGACGAACGTACCTGCGCGTGACCAacgtcggcgacgaagcgATCACACTCGACGCCCACACGACGTTGGGCTGGTG
GACGCCCGTGGACCTCCTACCGCGCGCTTTTGGCTTCGTTCAGCCTGGAGTCTCGACGCTACCGAGAGTGGCAGAGCCTGGCTTACGGCACCACTTGCAG
CGCCGATGAAGACGGGACGGATGCCGAACCTGAGCCAGAAGGACCGATGACCGAGCGTCCGGTATACCAGATCCCGCAAGGGATCATGCGCCGGGGCGAG
GGGAGGCTGACGAagcgagatgaaggcgcacGGATAGGGACTCAGCGGTGGCAGCGGTGACAGCGGCTCCGCGGGATACGAAGATGGCTGCACAGCCAAT
GCACACCTTCAAGACCGAAGAGCCAGTCAGCCAACCGTGGAAAGACGGAAAAGCGGTACCGCCAGTAGACATCGAAGGATCTCAGCTGGGAGACGTCCCA
AATCTGAAAAGATCTCAGCCGGGAGCCGAACGGTCGCCGCCGGAAGAATCGCCGCCCGTAACCGTCGAAGGATCGCAACCGCCAGCTGGAGGGTCGCCTC
CGGAAGAGTCGCCGTCCGTAACCGCCAAAAGATCGCAATCGCCAGCTGGAGGGCCGCCTCCGGGGAATACGGAAGGATCTCGTCCCCTGAACCAGGAGCC
GACGAACGAAACTGACCCCGACGACGCGGGCCTTATCCACGAAGGATCGGACCTCTTCGCagaagaactggaagcggAACTGGCAGTGTTGCCAGAGATC
TCGGTTACGGCAGAAGTGCGGATCGGGGATCTGAAGGTGGGAAGGCCGACCGGGGATACACCCGAGGATGCCGCACAACAAGAAGAGCGCCTACATCAGG
TTATCTGGAGGCGACGAAAATGGTTTATTGGGAAGGGCAATGCTTTGCCGCCCGCGGCCGTGGGAGTCGTCTGCGACATAGATGTGGGCGACGCGAAGCC
CGTAGCGCAACGCGTCCGCAAGATCCCGCCCCGATTCAAGGAAAAGGTATCTGACTTGCTCAAGGGCTTACTCAGTGTTGGCATGATCAGACTGTCCACG
TCGCCGATTGTCGTGATCGTAAAGAAGAACGGGGTTGACATACGACTCTGCATCGATTACCGACTGGTGAACGGACTGACGCAGCTGATGGTCTACCCGA
TGCCGCTCGTGAgcgacttgctggaggaTTTGGACAAGTACCTGTGGTACTGTTCTCTCGATATGGCCAGCGGATTCTGGGTCGTCCCCATGACGGCTCG
AGCCCAGCTCATCTCCGCGTTCATTACCCCGTTTGATCTCTTTGAGTGGCTGCGCATGCCATTTGGTTTGTGCAATGCGCCACAGATCTATCAAAGGCTG
ATCGACAACGCGCTCTTCGGATTCATGAGTCTGTCGACCGACCGCGATACTCGGAGCGTCTTCGACGAGGGAGAGCCGGAACCCCCAGGGATCCACTCCG
TCCTAGGTCGGAGATCGTACATTGATGACATCCTAATCGGCGGTACGTCGTGGGACGATTTGTACACGAAGGTCGAGCGGCTACTGGACGTCTGCGAACA
ATGGCATCTGTCCATCAGCATGGAGAAGAGTGAGTGGGGTATGTCTCGAGTCGACTACCTGGGCCACAAGGTCTCTGAAGCCGGAATTGaagcgaagccg
aagaaCCTGGAATCGCTCGCGACGTTGGAGTTCCCGCACACGCTCAAGGGTCTGCAATCGTTCCTAGGTAGCCTGAACTACTACCACCGGTTCATTGCAG
ACTTTGCGATCTACGCGACGGCACTGTATTCCCTCACAGAGGCCGACTTCGGAGCGTACACCACCCGACCGGAAGTTCACAGCCAGGAGAAGTGGATACA
CGCTCTACGCGCAttcgagacgctgaaggccaagatcgccAAGACGCCGATGCTGAAGCACTACGATCCAGACCGGGAACCGATGGTCATCGTGTACGCC
AATGAATGGGCGATCTCCGCGTTACTCGCGCAGGATCATGATGGTGTGTGCATGCCAGTGAGGTTTACCAGCCGCACACTCAAGCCCAACGAGCTGGACT
ATGACGTCGCCGAAAAGGAGATCCTGGCTCTGTTGCGCGTCTTGAACGATTGCTTCACGATGTTGGCCGGGAGGGCGATCCGTGTCCTGACACGGCATAC
GACGTTGGCGTGGTTTTTCCGATCTAAAAGACTAAAAGGCCGACTGCCGCAGTGGGCCGCGATGCTCTCACCGTGGAGACTGGATATATTCCGGTCCATG
AAGGGAGAGGAGCAGATCCTGGGAACGCTGGCCGCGAGTATCACACCTAGAGCGTTCGTTGAcatggcgctggaagagatCGCTCCACGTAGACGTCCGT
CGCGAATCTCTGTCATCCCGATCCCGACGGTTTCATCGGACAAAGAGCTGCATGTTGTCAGCTTCGACAGAtcggccaaggccaagcgcgaagGCGGATC
ATTCAGCGCGATTGTCTGGAAACTGCCGGGTTGAGAGATAATCCAAGCCGCATCGGGATACGCTTCTGACCTCACGGTCAACGAGGCGGAATACCGAAGA
TTGCTTCTGGGATGATCGCTGCTGGAAGGGCTAGAGGTCGCACGACTGGTCGTCTGTGGAGACTCGAACCTCGTCATCCGGCAGATGCGTGAGGAGATGG
ACTGTAAGTCACCGGGCCTGAAGTTGTTGCGACAGCGAGGTCGGAACGCGTTACAGGCTTGACCACGCCATGAGCTCTTTCACGTACGCCGAGACTGGAA
CGCGAGTGCGGATATGCTCGCTGGACAAGCCTATAGCGTCAGAGTGGGGTGACTGTTCGTGGCCTGGACGAGATCCAAGACCTTAAAACGCTGAATCGCC
TGGGAGAAATCATCCGACCGGAACTTGGAACGTCAGATCTGTCGCCTTAGCCGGAAGATCAGGCTGACGCAGAACGCAGAACGGCGCTGAAATTACCTGT
GGCCACGCGTTCCACCGCTGCTCGTGCCTCGACGCCAAGAGATCGAGAGCCAGAGGCTCTACGAGAGCTCATTGTACAGCAACTCCGACTAGACTGCGTT
TGCGTCGCACAGGACGAGGAACTGTGGATCGCGAACCTAAAACGATACTTGAGGGGCGATCTCGACGCGAAgcgaagaactgcagcaaggTCGCCCACCA
GTACGAAGAGGGCGAGAGCGGGCTGCTCTACTATC