Description :
From Genome Similarity Track
Location :
Scaffold_240:2- 4582
Transcript NameFunction/comments
Phyta_totarag6043hypothetical protein
Phyta_totarag6044hypothetical protein
Phyta_totarag6045small nuclear ribonucleoprotein Sm D3
Phyta_totarag6046conserved hypothetical protein

Sequence
4580 bases(100 bases per row)
GCTGGGGCCTAGGTGGCGTCGGCGGTCTGGGTGGTTTGGGCGGTCTGGGTGGTCTTGGTGGATGGGGACCCGGCGGGTGGGGCAATTGGGGAGGCTGGGG
CGGCTATGGTCCCTAccgcttcggcttcgtgcGCGGCGGCTACCCTGGCTGGGCCTACCCGATGGGCTACTGGAACATGTATGGTGCGGGTCTGTACGGC
GGTGGGTGCGGTCTGGGCATGTCCTACGGCGGTCTCTACTACTGCTAAGTTGGCGACTTGGTAGTTGAAGGTTGCCATAGAAACTGGCGCCCTTGCCTAC
GCGATTCAGCTCATGCTTTTGTTTCGCTCATGAGGCTTTGGAATAAACGATTTCTTTTGACACGCTTTGATGCAGTACGGGTTAGCACTGCCACCTTCGG
TTGATATGACAATATACCCGCACGAGGCTGCTCGTCTCTtcgatcaacaacaacaacaagttTTCGAGCAAACAAACTCATACTAACACGTACGCAATCG
TAAAATAGTTAATGTGAGCCGAGGTAGTTTTTCTCGGATACGCGATGAGACCTAACAGAAAAATGGCTACGATTGTAGGCGTGTTGACTGTGAAATAAAA
ATAGAGAGACCACGATATTTAGCCCCGGCAGCCAACGCCTTGCCCAAATCTACGCAATACTCGGAGTCCAACGGATAGCACTGCACCATACCCAGGACAG
TCACTATTAAGCCGTAAAAAACCTGCATGATCTCCCATGCGTGTCGAAAGTGGCGGTCTAAATGTAGTTGGTGGTCGTCCGACGGCCAAAACTCAATGAA
TGAGCGATTATTTCTTCTCATGACGACAAGGTCTTAACTTAGTCGAGGACTCTAAAAATATTGATCTTCGCTGCTCCCAAACCCCACAGGTGGAACACTA
CCCGCAGAAGGCAGTGACGATGGCATCTGCGTTTGCCATGAGTCCTATCCAGCATCCAGGAGCCAAATTCGCACGAATGGACCCGATTGACCCACGAGCG
ATGggtgcagcacgaagacgacgaaaagAGACTGTGAACGAGAAAGTGGAGCACATTCTGCGAGGAGCATTGCGcgacgccgaagaagacgcgtTGCAGG
AGCGTGAAGGTGGCCCTGAAACGCGTGGACGGGCATTGCAGCGCTCACGGCAACTGTCATCCTTGTACACAACTTCGACAGAAAGCAAGTTCCTGCGCTC
TCGAGCGAAACGAGATGCGTCAATCCAGCTCGGTAAAGAGACGAAGGCCAAAGGAGACTCCGAGTCGTCGATGACACGTGTGAAATCAAGAGCAGGGTCG
GATTGCGTAGTGAGGGCGATCGGGGAAGGCAACGAGAGtgacgagagcgacgacgacacatTTTCAGTGGGGCGGTTGGTGCTAGCGTCTCCCATTAAGC
CAAGTGTAAGCTTACCATCTCAATCCCCGgttccgacgacgacgacgtcaccTGTGAAACTAATCAAGCCATGGTACAGATGCAGCCCCACAGCAACTTT
GAAGGAGCAGATACCACCAGGAATTACTCTAGATGCGAAGTTGCGTCGCTATGGAGCTCGAGGCACGGCGAAACTTCTTCACGGTTGTAGGTCTCAAGAG
GCTCTTGAACCACTTTCTCCGAATCACCCGCTGGTTCCTGTTGACGAGTTTGTGCCGGGGATTAGCGGGTCACCTTCGCTTTGGCGGCCAGAAACTTTTC
ACCCGACTGGTTCTCGTCTGCAGGTTACGATGACACGTTGTCCCTCGTCTCCTATCGCTGTTTCTGTCGATGTTTCTAGCTCAAATGATGACCACAACAG
CTCGAATCACTTCGACCACTGCCATTCATTTGCCGACACGCGGGAGACtttgcagcagaagacaaCGGAGAAACTTCATCGTGCCTATAAACGAGAAGTG
AAGGTGGCAAAGGAGGAGCGCATGCAAAATCAGCGAGATCTCTCCGAGTGGCAGAACCGCACACTGCATTTTGAACCTTCATCTGAGCTGGCTGCTCATC
GAGAGCAACAGAAGAGCGATCCACAGCTTCGCCATCGACAAACTCAAAGCTCAGCAATAGTCCAGACACCAGGTTATTCTCCtgagaagcagcgcagcag
cgagtcgagCGAGTTAAGGAAGAAGAGGTTCAAGCTTCGCTGGCAGTCGTTTTCGAGGCTTCTGGACGCCATGCGACGCACACCATGTAGACGGCCGGTG
CTCCAAGATATGGAGAAGTTGTTCGCACTGGCTAGAGAACTGGGCGCACTCAATGCACTTGGTGCTTGTCTGCTCTCTCGCTCTCAATTCACACAGCTTG
TCACGAAAGAGTTCCCGTTGTGCGATCTCAAGTATGTGAACCGCTTGTTCTCGTCGTATGACTGGGAGATCCGTGACTCTGTAGATGCCCGCATCATCCT
TGGCACTATGCGGGCAATGCGCGTTCAACAAGGCGAACCTGTGGAGCTCATCTGCGCTTCACTATGGGACTTTGATGGTACAACCGATACGAACAGCAAA
ATTGTGAATGACAACAAGACTGTGGTCTCGGACGGGGTTTGTCTGACTAAAGCACTTTCGTTGTGCTGTGTtagcgacgatgaggagaaggaaaTGGAGT
CGAGAGCCGACGCTGTTTGGACGAAGACTCTCTCTTGGCAACGTCAGATTCTTTCGCGCCGTCTGCATGGGGGTATTCGACACAACGTGTGGAAACGAAA
CCCAGGAAGTATTGCGAGCAGCAGTGCGGTGGCACGTGTAGCAGACTCCGATAGCTatggaggagacgacgacgtagTGAGCAGAAAGAATGGCGAAGAT
GGACAGGGGAACGGTAATGACGATGACgccgacgatgaagaggacaGTAATGAGGAAGTACCCGAACTTATTCGGCTGGTCGATGAATCTCGTGTGCCCG
TGCGGCGTATACGTGAGGCTCTCAAGCGCGAACGAGAGACACTGGCGCTCTTCACGCAGCAACtactgcagcgtcgacacgaATGCTTGGTTGGCGCCAG
TACGCCCTCTCCTAGGAGgtgactacatgtagttgagGGAAAACATTAAGCTTGCTAAGTAGGGATGGATCACTGGAGCAGTTGGGCCCACAGACCAAGG
CGCTTTAGTGCACTGGGGGGCGGAGCACTaccgccaagaagagctaCGTCGCAAAAGTCACGGATAGAGTCTACAACAATATACCCTTCTGTGGTTTGGT
GCATTCGTCCGTACGAGTCCCGGTACCGGAGGCACCTTTTGTCAAAGTAGCCGCCATGCAGAATACGCAACTTTatcatcttcagcaacatAACCATCTT
TTGACGTAAGTTTACTTCATGTCGTCACTTCATATCTCCACTCCAGCGTAGTGAGCACCCATCCAGTCcagccgccaccgccgacaTGTCCAAGACGAGC
GTGGGGGTGCcgatctcgctgctgcacgagggCGAGGGCCGCACCGTGAccgtggagctcaagaacggCGAGGTGTACCGTGGTCACCTGGCGGAGAGCG
AGGACAGCATGAACTGCCAGCtgagcgacgtggtgctcacGCAGCGCGACGggcagaaggccaagctggagctcgtgtaCGTGCGCGGCTCGCAGATCAA
GCTGGTGATCCTACCGGACATCCTCAAGaactcgccgctgctgggaAAAGTGCAGGCgctgagcaagaagaacgaggaccagaagaagaagaagtccacg
GGTAAGACGCAGCGCAAAGGAGGCAGGCGCACAGGGCCCGGCGCGGCGCGCAAGTAGAAAGAGAcacacggacgacgacagagcTACAGAACTGCCGAAA
TGGCTGCAAATATGGCAGGATTTACGTCTGATGGacgatagcagcaacaagcagcaataCAGGAGACTGGGGCTACGTGATGGAGCTGAGACTAGTGCcg
tagagctgctgccgacggcTTGATTGGCCTGGTGATGCTGTACTAGGGTTTCTCTGAtgattgaagcagcagtttgaacttgaagacgaagacgacgtga
CTTTTTATTGCTTTTTGTGTTGATGGTGCTGTTGTTCTGCCCCGTCGTGGGGCAATGGTTGATAGTTGTGGTACCCGAAAACTGTTTCTCTTactttctc
ttcttcttcttcttcttcttcttttctgGATGCGACGAGCCAAGCAGTTCTACCCACATGTAGACGAGAGTGCCACCCGCATCTATAAAGCTGTCTATAG
CATCTCTCTTCCTTGCCCCCTACAGACAAcagagcggcagcagcagagctgGAGGCAGCAGACACAGCGCCACCGGCAGCGACAAGCCGCACGTGCAGAC
GctgatcaagcagcagatgaagatcATGATCCACAAGAGGATGGAGAAGCCGAAGCAGCCGCCGTGCAGTCGTCGCGACAAGTCCAGCGTGGCGTGGTTC
TGGATGCCGTAGTCCGTCAGCGACCGCGACGCGCGCAGCGGCACGCCACCGTAGTTGAGGTATCCGCAGCTGCGAAGGccctgcttcttggcctccacca
gcgacagcagctcctgcacttTGGCCCGCGGGTTGGCCACCGCGACGGTCAGCGTGCGTCCGGCATCCTGCACACGTCAC