Description :
From Genome Similarity Track
Location :
Scaffold_77:2- 4579
Transcript NameFunction/comments
g11538.t1hypothetical protein
g11539.t1hypothetical protein
g11540.t1hypothetical protein

Sequence
4577 bases(100 bases per row)
GCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAAAC
CAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATCGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCA
TACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAATAGTAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGT
CCCGATGTCGGGACATCGTGGTACTCGTACGTGATCTTGAGCTTCAACTCATGATCATCCGGCACGACAATGCAATCTGCGTTGTCGTCGACTGCGCTGT
AAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGAGCACAAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTC
CAACAACTGCTTCGCGTCCGCATCATGCGCGTATGCGGCCTTCACGTCGTCCAACAAGGACGACGAGGGTGTAGTCGGCCTCTTGCACCGCATAATCTGG
TCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTT
TGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCACGTAGATACACTCGAAACTTTGCGA
GTGCATACTTTATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCCGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACC
TTCGTGATCGAGTTGCATCAGTGCGTATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGC
GCCTCAGCCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAA
TCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGAT
CACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCG
CGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAA
CACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGC
ATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTAAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGAT
CCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGCACCGTCGCATCGTTCAGCTTGTT
GTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGA
CGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTTGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGT
GCTGAACACCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACGTCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAG
TCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGAGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCAGCTTCACACGTCA
CCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTC
CGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAAC
TCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCC
CGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGC
TTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCG
GCTCCCAGAGCCGACGCGTCTTCTTCACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGT
TCCGGACGCTTCGAGACCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATTTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGATCG
GAGACACCTGCATTCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGCGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGC
TGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGGGCAAGCCATGGCATGCCCAACACCATATCGAACTTATCGTTCAA
TTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTCCTAACAACGACACCCGTTGGTAGC
CTCACTTCCAATAGACTTCAAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTA
GAGCACGAAGAGATCTATCTATCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGG
GGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTAGTCCCTTTAGTTTTTTAATTGC
CCGTGGCGATACTGGGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAAC
GCACATTCGTTGATCCACGACGCTGCTGGTTCCCTGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCATGG
CATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCGTCTTGCATTGCGAGCGCAATGACAGCCTCGAGGGTATTGGGATACTCT
CGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATATTCGAGACCA
AGTACCGTGCTCTTTGGGCGTAAGCATGCATGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCAGAACTCGTTCTGCGGGGGCTCAAA
CGCTAGCTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGA
CATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCCCCCT
CTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGTGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTT
CACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAAAGACCTC
CCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTC
TCAGCCCCGCGTTCGTATTCCATACGAATGTGTTCTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCAATAC
TTTAGCTTACAAGTGTGCGCACGTGTATGAGGAAGCATAGGAGTATTTAACTTAGATTCAGTATACTTGTATCCGCG