Description :
From Genome Similarity Track
Location :
Scaffold_2167:2- 4466
Transcript NameFunction/comments
Phypl_g14767hypothetical protein

Sequence
4464 bases(100 bases per row)
GTCGAGTGTCTAATGATCTTGGCCGCCAGAAGTCCCTTGAGCAGATCCGACACCTTCTCTCGGAATTGAGGGGCGATCTTCCGCACCCGTTGCGCGATAG
GCCTGGCATCACCTACGTCGATATCACATACAACGCCTCTGGCGGCTGGCGGCAACGCATTGCCCTTGCCGATCAGGAGGTGTCGCCACTTCCAGGTCAT
TCGACGTAGCCGATCGATCTCCTCAGGGGTATTACACTTCAGATCTCCCACTTGAATATCTTCGATCGTCACTTCGTCCGTCGTGTTGGCGCTAAGTTCC
GGAAGCACAGCCAGCTGTCCTTCGACATCTTCGGCCAGTAAGTCGCTTCCTTCATGATAGAAGATCGATCCATCACCTGACGGGTCCTCTGTTCCGACAC
GTTTTTGATCTGGTCGCCCCTTTCGTATTTCTTGATCAGGTCGGTCCTTTCTCACAGTGTGGTCTTGAATTGAGTCTTGATCCAGATCCGTGACGTCGGG
ACCCGCTCGCGGCATGCCGGTATCAGGACCTTGATCAGACGAGAGCGGGTTTGCGTCTAACGGCGAGACGACCCTTTCGTCTTCCGATTTTGATCCCagc
cgtccttcttggaTCTCTTCTGCTTCGATCTCTTCTATGGACTCTCCAGTCGGATTGTTCGCCTGAGTGTCGGTGCCTGATCGGACGTTCTCTTCTGGAT
CCCGAGTCAGGTTGACCGACATCACCCGTGGGGATTCCAACGCCTTCTCTGCTCCATTAACAGGATCGGGTATCGTAACACCTGACCGATCCTCGAACCC
GACTGGAGCAGAAGATCCGCACTCATCCTTGATCGGTGCATCCCTTCGCAATATCGCCCGCGGTATGGAATACACTGGGCGCTCCACTGCCGGTCCAGGA
TCAGGTAGGTCTGCCTCCGGGGGAACGGCCTCTACCGTCGCTTGGAAAGCCAGATTCTGCCATTCATTATAGCGACGCGACCCGATTGAGACGAACCCTG
GTAGACGGGGAACCCGATCTCCAGCTAGCCACATCGCGATCCGTAATCCTGTTGGAGGATGAGGCGGCGATCACTGACATTCATGATCCGCAGGTATCGG
CGTCTTCCGGGTCCTCCCATCGCCGTCGGCACCCAGCGATCTCCGCGTGTAGCCCATAATTTCTCTCGACCGGATAACGCACGTAAACGTATAGGAAGTT
CACACGATTCCCCGATCTCTATCTGGAGATGCCCACCTATCGTCACCAGCTGGACTCGATCATTGTAAAGCTGCCGTCGACCACTGAGTTGGATCTTGAT
CTCGTCTGGTAGGCAGATTGATCCATCTGCCAGATCGAGTCTGATCCCAGTGGGGACCATGAAATCCATCCCCAGAATCGAGTCTTGACCCGACAGATCA
CCGGCCCAAATATCGAAAAAGTAGACCAGCGATCCCGCCGGGGTGATCTTGATCTGCGTCCTTCCTTCCGTGACGTACACGTTTTCGCCGATCCCGATAC
ACTCCTGACTCTGACTCCTATCGACATGGCACCCAACCTTACGAGCAAAGGCGGTGTCCACAATGGACACCTCGGCACCAGTAACTAAGAGTAAGATCGC
CTTATCATTGTTGATCTTGCCTGTCAGCTTCGCCTGTCGAAACCACTTCCCGGGAGCATGATGTTTCCAGTAGCCTTGGGACTCTCCTTGTAGGAGACCC
AAATACATCATGACATCCGATCGGCGATATTCATCGACTTGGCGGAGATTTGAGATCACAGCAGTTCGTTTCTCATGCAGATCACACGTATTATCGCGCA
GATCTTGTTGCTGATCGCTAACTTGATCTATCGACTTCTAGTCCACAAATGCATAAATGCAGAACCTAGAACGCTCGGCTCGTATCGGGTTCCAACCCGA
CGAGCGTCCTAGTTTAACATCTTCTCAGCCATTGCGGGCAACATGCCTGCATGCTTGGTAGGGTTGTACCACTGGCGGATCTGGTTGTAGAATTCTTCCA
TCGGGCATTTCCCCATGTCGTGAAGCTCTCCACACCCGCGGCACACGAACAGACAGTGATCCACCGGGTGGCCTCGCTTACCACACTTTTGGCAAGTCAA
ACGTTTCCAGCAGTCCAGATCCGTATAGTTACGGGAACCACAATGCGAACAGCGACTGCGATCCGATCCGTcgggaggcagcagcgatctGCGACCATGG
GGCACCTGATCTGTCGTGATCCGACCCGGTGGTAACCGATCTGCCTGGGCGATCTCGACCCCGGCCGGAGGTGGAGTAGCTTCTGCTGACGCAAGGTAGG
TCCGACGTAGATCGTCCTCTGAATCAGATCCTCCAGATCCATCCGAGCTGGAATCCGATCCCGACGGTGGATGCAAAGACTGGATCGCGCGTACTGCTCT
CTTGGCTGGGGCGGCTGACGCAGCCGCAGGGGTCTTCTGTCGATACTTGGATCCGAAGGCCGATCGTTTCTGTCTACTCTTCGCccgttctcgagctcgg
AGGACTTCTTCCAACCCGTCAGCATCCGAAAGCCGTAATAGCGTCAATTGGTCCGCCAGATCCTGATCTCCGACTGTTTCGATGTAATGATCGACGTGCT
CGCGGCGGTCCTTTCGGTCGCAGTCCTTGATCTTTAGTCGTGCACGTAGACCCGCCACGCTCAAGCGGTAGAGGTACTCCAGCGGTGATTCTTCCGATCG
CTTGCGAGCATGATAGTACTGCCATGCGACCGAGACTCCAAGTCCGCAGTACTGGACTTGAAAGCTGTGAAGCAGATCGCTCCACTTGTTCCTCGTCGAT
CAGCTTAACTGGCGGTACCAATACTTGGCAGGTCCGGTCAGCAAGTCTGCGAAGGTCAAGCACTTCTCGTCATCCGAGGCTTGGTCTCGCAGGAACGCCG
ACTTGACCTTACTGATCCATGATCTAGCACGATCTTTGTCTTGATCCTTGCCGGCAAACTCTTTTAGATCCGAGATCGCAGAGATTCGGACACGCTGGAT
CAGTGAAGATCCGCTCGCTCCGCCTGATCCGGTGGCGGCGGTTGCCACCACAGCACGGCCATAGCTTGGCATATCGAGATCATCTGGGTCGTACTCTCCA
TGAGATGGACGATGGTGTGGCGATCCCACCGACTCCATATCCACATCTTGAGCTCCCGCATACTTCGATCGATCTGCCGCTTCCGGTGTGATCGTTATCT
GCTGTTCTTTCAGGAACCGGGTCATGGCGGCTTGAAAGTACGTCTCGAGCTTATCCGTCGGATCCTTCAGCGTCACCGCGTCTGTGATCTGGATAGCCGG
GCTCGATGACTTCTTCTGTCGATCTGCCTTGGACGGTACACGATCGGGGGACTTCAGGCGGGATCGCAGTAGCGCTGCACCTGAGGGTCCTAACGACATC
CGTCGTGGGACGGTCGAGCTGTCCGAGTCTGGCTCTGAAGTGGCGATTCGTAGTGCGATGATCCCGTCTGGGcttcggtggtgctggccggTGTGGACAG
CTGCCGATCCCGCATCCCAGGGGGTTCACCCACTAAGAGCTTCAGTATCTCGACCAGCTTGTGAGTTGCGGATCGGATTACCTCCAGATCTAGATCGAAC
AGATCGTCGGCATCGAACGCTCCTGCCACCAGACCAGCATCCTTGAGTAGCTCGAACAAGACCttcaccgcgtccagcttgttcGACGTCGCCAGAGGGA
TCGCTACCGGACCCTTCAGATCGCCGATCAGGCGTACCTGCATGATCCTCATCACCGGATGATGGACCAGGAAATCGCGTAGGGTCTTGTGGTGATACAC
GATCTCGATCGCGTCTGCCAACCACGTCGCTGAGTGTGTCACAGCCGGATCTTCCGCATCTGACTCtggcgtcttcagcttcttcttcgcaaccttgctc
ttcttcttcttctgcgacgATCTCGCAGGGATAGGAGTCGTGTACACATAGGATTCAGCTTGGACCTTGTTCTCTTCACTCGGAGTAGCGAACGAGTAAG
ATTCAGGCTTGATCTTCCTGTGTTCACTAGGCAGATCTCGATTCGCATCGAGATCTGCAGGGGTCCCCGAAGGGACCTGGGGAGGAGTTCGAGGTTTCTC
TTCTAGATCCGGATCCGAATCGCCCTCATTTCTGTCAGTCGAGCTCCTCCTAGGGCTCTGCTGATCTGAGGATCTTGTTTCattcagcgtcgtcgtcgat
ccgATCTCCGATGACGCTTGGTCCCCTTGTTCTTTCTTCGCTTGCGAATCTTCTTCTGCGAACTCACAGTGAAATCCTGAGTCCCCAAGAGACCCGGGCA
CGCGCATCATTGTGGTGTAGCGGGATCGGCCAAAAACTTGTTAAGGCCAGATCGAGCTTCCCAACAGCGCCCAGgcaccgactaacggagggggtccCCG
ATCTGCTGAACTTGTTCccaccttgtgtacccgtcggtgggCCTGATCTGCTCTCTCGGGACTC