Description :
From Genome Similarity Track
Location :
Scaffold_969:2- 4463
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_969-fgenesh-gene-0.0General transcription factor IIH subunit
Pytar_ATCC12531maker-par_contig_969-snap-gene-0.7Amino Acid-Polyamine-Organocation (APC) Family

Sequence
4461 bases(100 bases per row)
CGTCGATGACTGAAAACTTCCAGAGTGGACTGATCCATGCCCGTGGCGAGAATAGGAACGCGCCAGTTCTCGGAGTTCACGCATTGATGCAATGTCATGA
ACCCATCATACCGAACGATNNNNNNNNNNATCGACGTGGTGGCTATCGGCAGCGGAATCAATCAAGATGAAGCAAAACTGTCGGCTACAAGTCAAAGTGA
AGGTGCGCACGATCACGAGTTTCCTCAGCCGCCCCACGTAAGGTGATTCGCTGAACACAGGTTTTGCCGTNNNNNNNNNNGTCGACGTGGTAGTCCTTGG
TTTTCGATCTATCGGCAGCGGAATCCATCAAGATGAAGCAATACTGTCGGCTACAAGTCAAAGTGATAGTTTCCTCAGTCGCCCCACGTAAGGTGATCCG
CTGAACACAGGTTTTGCCGTGGTAATAATTGCTCTATTACCGTACAGGCTTCTCGTGAGCGGAGTGGCGATCTCATTGATGACCGAAAACTTCCAGAGTG
GACCGATCGATGCCCCGTGGCGTGAAAAGGAGCAGCGAAACACGTGCCAGTTGTCGGAGTTCACGACAGTGCATTGCACTGTCGTGAACCCATCATACCG
AACGATAAATATACGACTTATTTGGGTCTATATCTGTAATTTATTCCATCGTTAGCTCCGAAACAACACAAAACCAATTCGCACCCAAGTACACACCATG
GACGGCGCGGCGGCGACGGCGCAGAGCGCGCTCCTCAAAGGAGCCGACACGATCACCCACCAGGAGGGACTCTTGGTGCTCGTGATCGACACGAATCCAG
AGCACTGGTTCCCCAGCGCGAAGCTCCAGAACGCGCAGAGCCAAAGCTTCCAGCAGCTCATTTCCAGTGCGCTCGTGTTTGTCAACTCGTATCTCTTGCT
GCACCGCAGCAAGCGCATTGTGATCATCGCAGCCCACGCTGGCCGTAGCGAGATGCTTTTCCCCGATCCTGACCAGCTGGATACCTCGGGGCGCGCGGAG
CAGTCGCTGAAAGTCAATAGCCGCGTGATGGAGAAGCTCCAAGCGCTCAGCAAACTGCCCGTGGACCCGGCAAAGTCGAGTGCGACGGCCATTGCGGCGT
CCATTTCCAGAGCGCTGTGCTGTACGTAGTTCTATCGAAAGCTTCCATTCTAAAGGGGATGCTGNNNNNNNNNNTCTGTGCTGTACGTAATCCTATTGGA
AGTTTCCATTCTAAAGGGGATGCTGAATATTGGGCGTTCGCGTTCCCCTTCGTATGTTGTAGTCATCAACCGAGCGATCACCGAGCAGGCCGATCTCCAC
CCCCGCATTCTCGTGATCCAGAAGTCGCCGGATGTCTCGGAGCACTACATCTCCATCATGAACGGCATCTTCTCGGCCCAGAAGAAGAGCGTCGCGGTCG
ACGCCTGCATCTTGGCTCGCGACCACTCGTCGTTCATGCAGCAGGCCGCGTACCTGACCGGCGGTATCTACTACAAGCCCAACGACGCGGGCGCGTTGCT
GCAGTACCTCGTTTCGATCTACCTGCCCGAGCCCAGCATGCGCAAGCTGCTCAAGCTGCCCACGCAGGACTCGGTGGATTTCCGTGCCATGTGCTTTTGC
CACCAAAAGGTCATCTCCACGGCCTTTGTGTGCCCCGTGTGCCTCTCGCTCTTTTGCGAGTTCAAGCCAATTTGCTCGACGTGCGGCATCCGCAGCCGCA
TTCAGCCGACCAAAAAGACCCCGCCGGGCAAGCGCATCAAGCCATCGACGTGAGGCGAACGTCGCGAAAAGAGCAATACACTACATAAACACCTAGAGGG
GACATCTCCCATGACGTCACCATGACGACCCGCGGAACGGTGAAGGCGCCACAAGAACAATCTCAAGCAGTGGGATGACGTCTTTTCAACCAATGAAATG
CGGTTTTGAAGGGTTTTAGCCAATCAGATCACGAAATCTGATGATGTTGACTGGATTGGTTGATGGATCCGATCCCATTTGATGGGCCAAACACCTCTCT
GCCGCGTGGGCCATCACAACTGAAACGCCACGCCCGCCACGACAGCGACAATATGAGCAGGTACGAGAGCGATTGCCCATGGGTCCCTAGTGTGTATAGG
TGGCGGAGACTCACTGGTGCTGTGTTCAGACCGACCATTAGCGAGGTGTTCCAGCAGGCCAAGGCGGCCCAGAAGCCAGCGTTCATCACGTTCACGTGCT
GCGGCTTCAAGACCAAGGCCGACACCGTTGAGATCCTTCTCGGCCTTCAGCGCGGCGGCGCCGACATTATTGAGGTGCGCTTAACACACCTCTCTATGCG
TCTCTGTGGGTCTAATATGGAGATGCTCACTGTTGCAACTGTCCACAGGTCGGCATCCCGTACTCGGACCCGCAGGCCGATGGCCCGACCATCCAGCGCG
CCCACCAGATTGGCGTGGACCAGGGCATCACGCTGCGCGACGTGCTCTCGACCGTGAAAGAGGCGCGTACCAAGGGCCTCACGACGCCCGTCGTGCTCAT
GGGCTACTACAACAACTTTCTCCAGTACGGCGAGAGCAAGATCTGCGTTGACGCCCACGAATGTGGGTACTTGCCCTCGTGATATTCATGCGCATGGACC
GGATACTGACAGTGTATGTGCTTCTTGGAAGCCGGCGTGGATGGCTTCATCATTGTGGACCTGCCGCCAGAGGAGGCCGCGTTCCTGAGCGGCGAGGCCG
CCAAGAATGGACTCGCGTACATTCCGCTCGTGTCGCCCACGACGACCGAAGAGCGCATGGCAAAGATCGGCTCGGTCGCGCACGGCTTCGTGTACTGCGT
GAGCCTCACGGGCGTCACGGGCGCGCGCTCGGAGTTGCCGGCCAACCTCGACGCGTTCATGGCCAAGAGTACGTCCACTGATGCGAATGGGTGATGACTG
AGGGGGGGGGGAATCTCTCATCGTCGATGGCTTCTCTTGCTTGTTGTCTACAGTCCGCAAGCACATTTCGCACCCGCTCGCGCTTGGCTTTGGGCTCTCG
AGCCGCGAGCACTTTGTGCAGGCCGGTGCGTTTGCCGACGGCGTGGTCATGGGCTCGAGCATCATCAAGGTCATCGAGGCCGCGCCCAATGACACGGCCG
CGCGCGCCGCCGCCGTCGAGGCGTTTTGCAAGACCATTGTCCAGGACGCGTAGAGCCCCTCTCTCCTGTACTGTACGCGTAGCAGTAGATAGCGTTGATC
CACCATACAAAGATGAGTTGCCGCTGCCAGAGTCCTTCCTTCCATACAATAGCCAAATGCGCCAGACGCATGCAATGGAGTGAATCGCTCATGTTGGCGT
CGGATAGCGCTTGTGTATATTCGTTTTGTATGGGTTATTATTGTGAGGAAACCCAGGAAGCATTTTGTCCGCGTCGTTACGGCACTCGCATCTTGCTCAT
GTCCGCGGTCGATGGCACGGGTTCGAGTCCCGCCATGGTCCTGGAATTCCCTGTGTTCATGTGTGGCGTCTGTCCGGATAATTGTCATCCGGATAGAGGT
GGTTAAAACCCCGTTTCGCATTCTTCGAAGCCCAGCGTGTCTTTCCCATTGGACTAAAGGCAGGGTCAAAATGAGTGCAATAGTACACTGGGTGTAGGAT
TTGCGGCCCCTGCGGGGTCACAATTGCCTGCATACCTCCCGCTCATCCGGGTGTCTGGCCTGCGCTTACCCCAATCGCAGATTTCAGCCAATCGATGGGC
TCACAGCTCTCTTCTTCTTTTTCTTCGTCGGAATAGTTTTGTACCCCATGGGGGACTAAACTAATCTGCGTCAGCCGAAAAGCTCTTTTCCGCTACAGCA
ACGTCAAAGAGAAAGCCGCGAGCGACCGTCGTGCAATCCGTCACTTCTCCGCTTCGTAGCTCCTCGCCGTCCCCCCAATGGAGCAGTTTGTGGCGGCCAT
CGGCCGCATCAAGCCCGTCGAGAATTGCCTCGTGGGCAAGACCAGCGATGGCGGCAGCGCGGTGCTCAAGCGCAGCCTCACGCTGGCCGATCTCATCGCG
TACGGCGTCGGCTGCTCGGTTGGCGCTGGCGTCTACTCTCTCGTGGGCGTCGGCGCGCAAATCACGGGCCCAGGGATCTCGCTCTCGTTCCTGATCAGCG
GTGTGGCCTGCATCTTTACGTCGCTCACGTACTCGGAGTTTGCAGCGCATGTGCCGGTAACTCTCGACTCTAGTCCTATGTGCATTGCATGTGCCACGCT
CACGACTGCGCGCTTTCTTGGTGTGGGGATTCTAGATCACAGGCTCTGCGTATACATTCGTGTACATTTCATTTGGTGAGCTGGCGGCATGGCTCATTGG
CTGGAACCTCACGCTCGGGTACGGCATCTCGGCAGCGGGCATCGCGCGCAGCTGGGCATCATACGCCGAGTCGTTTGTGCATCAATTCGGGCTACAAATC
CCGCACTGGCTCGTGCGCACAGAGCTGTTGGGCATGCAATGCAGTGCGCTGGCGGCGATGC