Description :
From Genome Similarity Track
Location :
Scaffold_1523:2- 4407
Sequence
4405 bases(100 bases per row)
TTCTTAGGAGCGATCCTAGTTAGCGCTTCATCTCATCTTAGCTCGAGGTGTGATGCTCGCGGTCAAAACTCCCAGGATCTCGTCTTCCCCTTTCGAACAT
TTCACAATCTCCGGTATCCAAGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGTGTAGAGTGTGG
GGTCAGGACCCAGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGC
TCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGCCAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAA
CTATTACCGTAGATTGACGTTCTAGATCGAATTGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCA
CCGCGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCC
TCTTCTGGCGTCGTACCACTTGGATTCCTTTGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAG
CGAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCAT
CGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAAATCTGATGGCCTAAGTATTC
CACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCC
CACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAGCACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTA
CTTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGC
GTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAA
AACCGCTGGCCATGTCAAGAAAGCAGTACCAGAGTACTTTATCCAAATCTTCCAGCAGCTCATTGATTAAAGGCATCGGATACACCACCAATCGAGTCAG
ACCGTTAATAAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATAAATACCACTGGGGATGCCCACGGGGACGTTGAGAAACTG
ATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGAAACTGAGGCGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGC
CGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTAACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACG
ATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCT
TCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTTACGGTAGCAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACC
CTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATTAGGTACCCTGGTATCAGGGAAACCACCTGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAACT
CGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCACTTGTGGATCAGCGGAATCCGGC
TGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTCAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTG
CTTGGATCTCGACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCAC
CTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCGCTGACACATATCCAGGTTGCCTAGGG
ATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGATCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTG
GCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTAACCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTCC
GGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCGATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAA
CAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGT
CAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCG
ACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTG
ATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTATTAGCAGATCCATGGATCCAACCA
CTTCAGATCCCCGGGATCCAGTAATCTGACAAACCTTGGGTGGATCTGCGGTGACCTCACCCTTGGTAGGCTCAAACCATCTACCATGTTGGCGCTTCTC
CCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACT
GCCACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTTACAAATGCATAAATGCAATACCTAG
AACGCTCGGCTCGTACCGGATTCAAACCCGTCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGAATCAAAC
CATTGGCGGATTTGGTTGTAGAATTCTACCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGAT
GACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCC
GTCCATGAGATCTCGGGATCTGTACATCCCACGGCCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGATGCA
GTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCATGACTTTGTGGACACGTCGAG
CTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTC
CTCAAGCTCGTCTGCGTCGGGGAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGT
ACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGTGGGGATTCATCCGATCTGCGGCGAG
CGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCAGAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAG
CTGCCGATACCAGTTCCTGACTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACT
TGCTG