Description :
From Genome Similarity Track
Location :
Scaffold_1588:2- 4171
Sequence
4169 bases(100 bases per row)
CGTTGGTATGGGGGGCGAAGATGAGGATCATGAGGGCGGATAAGCACAACCTGGATCGAGCCCGGGGAAACCTGGGAACTGCCAGATCGGTTAAGGTGGG
TGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCGACCGTAATCCAGGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAG
CGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGC
CGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTTG
ATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATAGAGGTTGGATCCACGACGGGGGACGATCCCCA
GAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTT
CCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTG
GTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCAACGAA
GACGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGTGGTGATCCCGGAGGTACCACTGACCACA
GAGGAGGTCACGATTGATGACATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGC
TGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGT
GGCGCCTCAGTTCCGAGAAAACTATCGGATCTGATTAAAGGCCTGCTGCAGGCCAAGATCATCAGTTTCTCAACCCCCCCCGTGGGCATCCCCAGTGGTA
ATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAGTCA
ATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCACGAT
ATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCC
CTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTG
GGACCCCGTCTGTGCTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGACCAGTTGTGCGAAAGAGTGACATCCCTACTGGA
GGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTCTCCAAGGAGGGATTG
GAGGCGAATCCTAAGGACCTGTCTTCGTTAGCGGACTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGAACTACTACAGTCGGTTTATCG
AGGATTACGCACTGCTTGCTGCGGTACTATATGAGTTGAGGGAGGTAGGCTTTGCTGCAATGACTACTCCAGCTGTCCGAATCAAAATCCAACAAGCTCT
GGCCTTGGAGCTGTCGGATCCACGAGGGGATCCAAGTAGTACGATGCCAGAAGAAGACCTAAAACAGGAGCTGGATCCCCCCCCCGGGATCAAAGGAAAG
AGGATCCAATCAGGATAGAGACGACGGATCAGAACTCGGAAGAGGTGGAGCTTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGTTGAGGAGCAGGAT
CGCAACCACACCTATCCTCCGGCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACGGGGCAGTCTCAGCAGCTTTGGTACAAGAA
CATGAATGGATTTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTTCTGC
GCGTACTGGATCTCATTATAACCTGCTGGTGGGAGATCATCCGGATCCTGACGCGACACTCTACGCTAGCTTGGCTGTTCAAGTCGGCCGGGTTACAAGG
ACGTTTAGGACAGTGGGCAGCTTTACTCTCGCCTTATACACTGGAGATTGTAAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGC
ATCACACCTCGAGCTAAGATGGACGAGGCGCTGACTAGGATCGCTCCTAGGAAAGAACCCGATCCCGACGGTACAAGTGGATGAAGATCTATACGTCCTG
AGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGGGGAGTATACAGTGCAACACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTT
ACGCGGAAGGCCCCACCGTCAATGAGGCGGAGTATGACGGGCTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCGAAAAGGTTGGTGATTTGTGG
GGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGT
TGGATGAATCACGAGTTGATGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATATCTTGGCCAGTGCCGCTTTACGGAATCAATGCGGTGTTGAGGTCG
AGAGAGAGGCCGAGCATCAGTATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCAGTCAC
TAGGTCCAGAGGAAGGATTTGATTCAGTCCCCAGATCATCGAGGAAACATTTGTGAAGAGAGTCCGCATTGGGCGGATCCTCAAAGCACAGGACGAGGAA
GCGTGGATCCTAGGACTAAAGAAGTATCTGATAAGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGG
TGGATCGGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGAGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACA
GGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAAAGGATCCGGGAATGTTTTCACTGGAGGGGACTA
TTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGA
CTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTTGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGG
GTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAATCGTACGAGGAGTGTGTCTTCCGAAGATTTGGAGCTAGCGAAATGATT
AGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCTAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAG
CTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACG
ACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACCCCGTTTTACTTGGTACATGG