Description :
From Genome Similarity Track
Location :
Scaffold_1087:2- 4122
Transcript NameFunction/comments
g16319.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g16320.t1hypothetical protein
g16321.t1hypothetical protein

Sequence
4120 bases(100 bases per row)
GTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGC
GCTCAGCTGGATTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGAATGC
ATCGCACACAACGTGAAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCA
GCAGGCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTATTTGCACAAGTACGTGGCGAGTC
CAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAG
ACACTCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGTGCTCAAGCAACTTGCGGAGATGC
TCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACA
AGTGCGTGACGCATCTGTTGAGCGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGT
GAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATAACA
TCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGA
ACGTAGGCGCGCTGTGCGGGGATTTAGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCATTGACTTGCTCACGCGGCAG
TGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGTAGGAATGTCGTCCGGG
AGTACGTCCTTGTACGCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGTGCTGA
GGGCGTTCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTGATCATCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATC
GTGCAGGTCGCGAGCGAAATGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTCTCCAGTCTCATCTTCTTGTATTGG
AGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTTGTCTCCAACTCCTGTGTCAGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTG
ACCGAGGCTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTG
TTTCTTGTATTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTC
GCAAGCATTTTCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGG
AGTGTCTTTTGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGTCCCTCTCGAATCGGATTGAACCAGGCCCTG
CTGATTCGGTTCACATCTTTTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGAGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGG
CCGCATGCACCATGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGT
CGATCACCGGATCATGCCGTCTAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTC
TTGGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCC
TCGAAGTCAAGCCTTGAAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCT
TCAGGATGACAAGGTTAGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACG
TTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTTGATTGCCCGTGGCGATACCCAGTATCGCCACGACGGCTCCTCGCC
GCGTGCACAGGTGCTGTGCACTCGCGAGCATAGTAACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAG
CTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCGGTTTAGCCTGCCG
CAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTTACAGGCCCATCTCTAAGGCCC
TTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCT
TGCCCTGGTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTTGTACGTGCT
AAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACG
ATACGTCGAGCCGCGATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAACTGCTTACGTGGAGTTTTAATGACT
CCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGTAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGG
TGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTTTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCT
GCACGTGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGT
GTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGGGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAA
GCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAATGAACCAAACGAAAGCTTTGGTGCCAAATGAGAAC
TGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCT
CATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCAACCTGAATGTATGCCTTAGTGCATG
TTGCACTAAGGTAGGAGGTG