Description :
From Genome Similarity Track
Location :
scaffold_1413:2- 4053
Transcript NameFunction/comments
g11383.t1 reverse transcriptase
g11384.t1 reverse transcriptase

Sequence
4051 bases(100 bases per row)
CCCAGAACCTTGTTGAACGATCTAAAGAAGTCAGACATAAATCCTGGCTCTCGATCGTGCCGGATCATCTCGCTCGACCCGAATCGTCGGAACACGCATT
CCTCGTAAGATTCCGCGACGGTCTGCGCTGATCGAGACGAGCTAGCCTTCGCGATCACGTATCCCGAGAACAGATCGACCCAGATCAGCAACTCCGTGTT
ACCCTTGTTGGATCTGGGCAGGGACGGGATGTGATCCATCGCAATGATCTGGAATGGGTACGTGGCTTGCAAATTTCCAGGTGATTCACCTGGATCGTGG
GTCTCCCTGTGCCGGTCTCGCAATCTACGCATTCACCCACATATTTCTGCACACTCCGATACAAACCTCTCCAGTGGAAGTGATCTCGGATCCGCTGGTA
GGTACGGCCGATTCCTTGATGGCCCCCTTCCAAGGTTGTGTGATAGTGGTGTAGAATATCTTGCTGAAGTGTTTTCGGAACAACCAGTCTCATCAACCCA
TCACGATCGTCGCTCGATCTCGTCGTAGGAGGACAATAGAAGAGCAGATCCTGCTCGTCTACCTCATAGTCTACCACGATCTTGCCATAGGATCGAGATT
CAGCCTGGGTAAGATCTGCGATCTGTCCGATCAGGTACTTCTTCATCCCCGCGATCCAGACCTCTTCATCTTGCGCTCGCTTAACCCGATCGATCCGCAT
CTCTCGGATCAACTCTTCTTGCAAGACGGCGGCGGTGGATCTCGCTCGAACGTTGGCCCGTGTAGCCACCGCCGAGACCCGTACCACTGGATCGTCGGAC
TTGGGTACCAGGATCTCGTCTAGCCGATTAAGGGTGACTAGATCCTGGCGACCCGCGTCATCGTGAACCTCGATCCCGTTTTGTCGTTGCAGAGCCGCAC
TCGCCAGGCTATCCGCGCTCCCGTTCCATTCTCTCTTCACATGTACTAGTTCGTGATCACTCCACTTTCTCAAGTAATCGAGGGCTTTCTGCTTCAACAA
CGTCAATCCCGGTGCCTTGCAGTCGATCTCGCCGCGAACTTGCCTGATCACGAGGTTGGAGTCACCACAGATCACCAAGCGTCTACGATCGAGGTCCTTC
AGCAGTCCAAGTCCTAGCAATAGGCCGTTATACTCGGCTTCATTGACAGTAAGACTCTCGGTGTAGCCTGATCTAGCTTTGATCACCTTCCACTCGGGCA
CACTCCTCACGATCGTGCTGAAGGCACCTCCACCTCGCTTCACACGGGCTGATCCGTCGAAACTCACAACACATAGCTCTTCATCTCGATCTACAGTGAG
GATCGGTGCTTGGATCCGGCGTTTAGGCTCCTTCCGGGGTGCGATCGCGGTTAGTGCCTCGTCGATCTTGGATCTCGGCGTGATACTGCTGCGATCGCCC
CCAGTATCTCATCTTCGCCCTTCGTACACTTCGTGATCTCGAGCGTCCACGGCGACAGGAGGGCAGACCACTGTCCTAGGCGACCCTGGAGCCCGGCCGA
CTTGAACAGCCAGGCGAACGTGGAACGTCTACTCAGGATCTTGATCTCACGTCCCACCAGCAGGTTGTAGTAGAGATCTAGGATCCGCAACAACGTCAGC
ACTTCCTTCTCCGCCACATTGTAATTCAACTTGTTCACCTTCAATGTACGACTAGCGAATGCAACCGAGTGGTATATCTCGTCGTGTTCTTGCATCAGCG
CGGCGGAAATCGCCCAGTCGCTGGCATACACGATCACCACAGGTGATCTCGTCGTGTCGAAGTGGCGCAGGATCGGCGTCGTCGCGATCTTCGTCTTCAA
GGCCGTGAACGCCTTGTGAGCCCTGATCCACCTTTCATCGGTGCTTCTGAGCTCAGATCCCGTATTTGACACGTCAGGTCGGGGATCGAGCGCCCCTGAG
TCTGGATTCGGGACCTGATCGATCGTGATCGATACCATCCGGTCCATGATCTCCCGTAGATCGGGCCGCTTCTTCAGCTCTGCGAACTCCACTTCACGTA
GTTCATACAGAACCGAGGCATATACCGCGTAATCCTCGATGAATCGACTGTAGTAGTTCAAGCTTCCCAAGAACGACTGCATGGATCGAAGTGATCCGGG
AAATGGTAGATCCGCCAAAGACTTCAGATCCTTCGGATTCGCCTCCAGACCTTCGATCGACACTTTATGTCCGAGATACTCCACTTTATTCAAACCCCAG
AAGCTCTTCGCCATACTGATCACAAGTTCCACTTATCGCAGGCTTCCAGTAGATCTTCCACCCTTTGGCACATCTGATCCCATGACCCGGCGGTGATCAT
GATGTCATCGATATAAGATCTGCGTCCCAGCACCGATGGTTGACCCGGATCTTCCGGGACCCCCGACTCGAACACATCAACTAAGCCTTCTGAATCACTA
GATCGCGAGATCTTCAGGAATCCGTATAGGGCGTTATCCACGAGATGTTGATAGATCTGGGCGGCGTTTTTCAAGCCGAAAGGCATACGGTTCCACTCGA
ACAGACCGAATGGAGTGATGAACGCCGAGATCGCGCGATCGGTCATCGACACAACCCAGAATCCACTTGCCATATCCAGTGAGCAATTCCATAGAACCTT
GTCGAGATCTTCCAGTAGATCGTTGATCAGGGGCATCGGGTAGATCATCATCCTCGTAAGGCCGTTCACCAGCCTGTAATCGATGCACAACCTGATATCC
ACACCGTTCTTCTTGATGATCACCACGTCCGGGAACGCCTAAGGTGATGTTGAAGGTCGGATGATCTTGGCGGCTAAGAGTCCCTTGATCAGATCTGACG
CTTTCTCACGAAACTGCGGCGCTACTTTACGCACTCGCTGTGCAATCGGTGTCGCATTCCCGACATCGATATCGCATACAACCCCTCTGGCGGCCGGTGG
CAGAGCATTCCCTTTGCCAATCAGGAGATGTCGCTTCTTCCAGATGATCTGCCGGAGTTTTTCGATCTCCTGTGGGGTGGCCGATCCCGGATCACCCACC
TGTAGATCCTCGATCCTGACTTCTTCAGTAGTCGAGATCTAGATTTCCGGGACAACGGCGAGATTGTCTGCGAGATCTTCGACTGAAAGATCGCCACTCT
CGTGATAATGGACTTGATCGCCGTTTTCGATCTCCCGGGGGGAAGTCGATTCTGGCTCTCCTCCTGGTGGATCTTCATGCTTGACCTCCACCGTCGCCTG
GATCAAGGTTTCTGCGGTTGTTGCGGTGTCGGCAGCGCAAGATTCGGACATGATTCCGGTTTGAGAACCTAGATCGCTCCTTTTCGCCTCGATCTTCTCT
TCGTAAGTTCGATCCGGGGCCTGATCTGACACGCTCTCACGTATCCCTCCGCCCCCAGCATCGCCACTAAAGGTCCCGCGTGGATCGACTCCAGACTGCT
TCTTAGATGTGTCGCCTCCGTCTGAATTGAGGAACGCGACTCGAATCTTGCTCGTGCCGGTCGATCGCACCTGTGATCGAGCCTCCAGACCCGATATCGA
GGAGGGTTCGCGATCGATCTTGGCTATTTCACCCCGGCGAAGTATCGATCTCGGTATAGCGTACGTCGGGCGTTCCACCAGCGGTCATCCCGGCTCTTCC
GGGATCTCAGGGGGTTCCGATCGAGCTTCGTCAGTGGCTTCTAGTGCTAGATTCTGCCATTCCATATAGCGGCGAGATCCCACTGACACGAACCCCGGAG
ATCTAGGCACTTTCTCTTGGTCCAGTACCATCCCAACGTTGAGACGATAATCTAGCCTCAAGATCTTCTCTCCAAGATTCGAGATCACCAGATATCGGGT
TCGACCTGGACTATCCACAACCGTAGGTACCCACTGTTCCCTTATGATCACCCATAGCTTCTCCGTAGCACCCAACTTCACTCTCGACGCTGCCTCCTCC
GATTCCCCAACTGGTATCTGCAGATCTTCCTCGAGAGTGATCGATCGCACCTTGTCACCGTACAATCTCTTGCGACCGTTAAGCGGGATCCCGACTTCGT
CGGGTAGACACATCGACCCCTTGGCGAGATCCATCCGGACCCCGGCCGGAA