Description :
From Genome Similarity Track
Location :
Scaffold_63:2- 4029
Transcript NameFunction/comments
Physo_138382hypothetical protein

Sequence
4027 bases(100 bases per row)
GAAGGCCCGGCAGCAAGCGCGTGACGAGGCGACGAAGCAGGAGATGGAGCGGCAGCTCCACAAGCGACGAAAGCGGCTCGATCACACCAAGGCGCGTCGA
GAGCGGCGTGCTGAGCGTGAACGGATGGCGGCTGGTGCAGACAGAGCTACTGGGGTTCATGCTGGTGAAGAAGCCGATGGTGACAAGGGAGGCGCTGCGC
GACGAAGTGGTGAAGGGCAAGACGAGCACGTGCGCGTCGGAGAAGCTGTCGGTGGTGACGAAGACGCAGAGGGTCGCGACGACCAAGGTGCGGCGGCGGA
TATGCTGCGCGGACGAGGACGAGCACAATGGCAGCCGCCAATGCCGGAGCTCCTGCAAGTGGAGACCGCTGGCTACATTGTTGAACGAGCACGCCGGCGA
GTGCGCAACCGCGCAGGACGCTACGTGCGTGAGCACCAAGTGGAGTACAGCACTGGGCCAGGACGACCAGCGGGACGGCGATGGCTCACGGAAGCAGAGT
TCGAGCAGCTCGAAGATGCTGCCAAGGTCGAGGACGACCTTGGAGCCGGGGATGGCGTGTAGTTGGATGGCCTGTCACGTGACGAAGGGCCACGAACAGG
CAGCGCCAGACGCGCTGGTGATCGACTTGACAGACGAGTAGTGTGGTGGACATCGGCCAGATCGGGTCGTAGTGTACGGCAGGAGGCGTGTGGTGAAGAG
GGCAAGCCAGTGGACTAGTGCCACCGGCTGAAGGCGGTCGTTTAGCAAGCAGTGGAAGTTGGTGATGGCGACGACAGAAGATCGCAGTGTGTGGGCGACA
TGCCGGGACAAGAGCGAAGAAGTATACGAGCGAGGAGAGGCGAGATCAAGGACAGGAACGTGAGGCTGTGAGGCCACGAGCATGGAGAAGGAGTCGAAGA
GGGAGAGGTCCAGTAAGTAGGCAGGCGCCCGTGCGTAGGAGTAGATACAGCGGGGATAGGATTGAGTAGGAGGATACTGAGCGGCGGTCGGCCGACTCGA
CCCTCAGTTGCGGTTTTTCATAGGATTGTGGAGAGTCAAGACTAATATACACGAGTTGCGCCGAACGCACGGGATTCCGGTCTTTGGAGCAGCGACGAAG
AGCGTCGGCCAAAGCGACGGCAATAGCGAAGGTACGGCAGTGGTAGGCCAGTGCACAGATGAGGGCAGTGTTCGAGTAGGGCGGCAGGACTGTGGAGAGA
GACCACGGGGGCTGTGGTGTTGGAGCACCTCGGTCGAGTGGCGCGGAGCTCGCATGTGCCAGTGTGCGAAGGGCTCTTGCTGCCTGCTGTATATAGCCGG
GCTTTACGAGCTGGAAACAGCTAGTGAGGCTACCCGACCACTAGTGCTTATAACGTTTCCTCCTAGCCATCCCTATCCTAGCCATGCGTGCAGGCCAGTA
ACGTCTGGTCGACACTGAACGGCCTCGCACTGGAAGAGACTCTGCTTACCGAGACGCTCCCTAGGTGCTTAGGTGAGCAGCTTGTGTTAACGATCTCCCT
CCGACGCGGTGCAAGAAGAAGGGCACTCGGAGTGGAGATAACGACAACGGTCTAAACCTAGAACGGAGACTTGCAAAAATGGTAGTTACCGACACTTTTG
ATGTGGCCCCGCCACTGCCTGCTACTACCCTGGATCTTGGTAGGTAGTTCCGAGCTTTATCTGGGGAAACCGATGACAACAGCGCCTCTGGTTGAGCGCG
GAAAAATAGATTTTTAGTGCGGAACAAACATATTCAAGTCAGCCCTGATCGCAAGGCATACTAAACAGAAGTAGCGCCGGGGCTGGTGGGCGTGTCGTGT
CGAGTGGGTGTCAACATAAATGCAACACAATGGGGTTCGTAATACAAACACAGTAATATCTGCCCCGTTTCTAGAATTTGAATGCTCTAAAAAGTGGTCT
AATCTGCCGGTGAGCCCGAGATTGGCCATTTCCCTTACTAAAACATTCTTTGTAGTAGGTCGCACTGAAAAAACGCGAACACAGATGAGAGAAGCTGGCA
CTTCCTTCAGTTGTCTACCGAGTGTATTGCGCTTGCCAGCTTTGAGATAAAACCAAAAGTGAGAAACCTAAACATGCATGTCGACTAGCTGCTCTACATC
ACCACAACCAGCGTCCCAGTGGTGGCACTCTTCACGACTTTCCGTAAGAGCTCCTTACTGCAACTTGCCCCTTCCACCTCGTGCCAGCTTGAGTCAACGA
ACGCACGCATGATGTGCTCTTGAGCACGCCAAGCCAGCACTCGCTGGTTGCGGCGCCGCTGCATACTCGGCCACAGCACTGGCTGAGCAACAGCACTCGC
TGAGCAACAGCGCACATGGCTGACTGCAACTGCATGCTGGCAGCAGCACGCTGCCCAGCATCGCCGCCGCACTCGATTGTACTGCGTGGTCGTGGTTGGG
CTTTCATGTCGCCACCCACTACAGTGAGTACCGTAATAGTGAGGTCTCCCGTTAAATACGCCGAACGGCTACAACAAGGTGCTCAGAGCTCCGTCGCGTC
ATGCAACTTGTCTTAGCGATTGCCTTCCGTTTGTTTAGTGCAGTCGCTTGACCGTTTATGCAATATTTACCAAGAGTGAATTTTTATGATGTCCCATACT
GATTCCTATATAAAATGCTGTCCCACAAATGTGTCTCAGAACCGTGTCGGTACGGAGATAAATCAATCTTAAAGGAGCAGCTGCAGGTCCGCGAGGGCGC
TCTTTAGTTCAACGTTCTTGTTCCTGAGAGCAGTTCTCCAACTCAGCTCGTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN