Description :
From Genome Similarity Track
Location :
Scaffold_1417:2- 3983
Transcript NameFunction/comments
Phyag_g10569hypothetical protein PHYSODRAFT_257835

Sequence
3981 bases(100 bases per row)
GCTCAGGGGTCTTAAAGAATAAGTAGCGGCTGTATATTTGCATATATTACTCTGTATTTTGGCTATCTTACAAGGGAGTGTGTTCTGGGGCTTTGTTCCT
GATCTAAAAGGGTGCGTTTCAGACAGTAAACGACACGCCCGACACGCACAAGGCCTGCattaactaccaactcggcaggttgtcaggttgccaccaagat
cgaaccaaagaggacacacaagggccacacgccgactctggaacgttcacgtttcagagtttctgaccccagttccgtATAGTTTATTagctctctggat
cccctgggtTACGGCACTGTACACTTGCAGCGGAAAAAGGctcaccgacctcgccacatgCGTCAGGGAAGCTgcgttgtgctgctgctgcgggagGGGT
CAGGCGAACGCTGTCGTGCAGAGGCAGGAGGCTGCCGCAGGTGCTGTCCAGTGAAGACGAGAGGCAGGGGGCGCTGTCAAGATGCCAACGAGGGCTGCCA
CCGTCTAGCAGTCGTCGTGTGGTGACGTGAACACGGATTCGCCGCCTGTATCGACTAAGGAGGTCGTACAGCGAGAACTACAAGGGCTACGTATGGCGGC
TGTCTGCTGTTAGCATCACAGCGGGTGCTAGGAGAAAGCTGTGCATTGCCTGAGAGAGCCACAGCCTGGTCACCGCTGCTGCCAGTTCCGCTGACGTAGT
ACCAGCGTGCAGCGGCATACAAAGCGTGCATGTACGGACACCAGATGCAGTATTGGTACGGATTATATGCAGTAAATCTTTCGCTCACTCCTGTTAGTTA
TGTCCTGCCTACTAACGACGCTCATCATCAAGTGCGTGCTTGTTGTTCATAGGCCacccagcagcttgcgcgACTTCGCGACCAGGACCGCGGTAGCAAA
AGCACTCTCGCTCCCCTCCGTGAGATCGATCGTGCATCACTAGGAGCGAGTGGACACATGCAGCATACTTCATATTGTACAGGCATGGACAGCGTCCTGT
ACTAGCGTCGATAACCCACACAGCTGGCGGCATTCCTTTCAGCTCCATCCGGCCGATGTGGTAGCGTAGCTGGGCGGTCACAGGAAGCGTCTCACGTGTA
CGCTCCAGCTCAGGGTCGTAGACACGGACGCTTGACTTCTGTAACACGTACACCACCTCGCCGGAGAGCCCCGAGTCGTTCAGCAAGAACGATATATTGC
TACGCGATGGTACGTGCCGATAGATGAGACCTTGGCGGCGAAGCTCGTGCTTTCTGCGCTTCAGGGTGGTTGTAGGGGCCGTGGTTACTACGAACTGACG
GGCGTTGATGGACTCATGTTTGCAGCAGGCAGACATTTGAGCAAGAAGCACGCCCATCTTGAGCCGACGGTGGAGCGTGTAATCCCGTTAGAGAGCCCGA
TTGAACTGCTCCGCGGGGTTGTTCGTCGTAGCGAAGCCCCGCGGCGTTCGAAAACCCTGCCACTCGTCAAAATTGCCGGTAAGCCACTGCTTCTTGAAGT
ACGTGATAAATGTTGCGAGCTCTATCTTTTGACCTCACTTACTAAggactttcttcttcgtttcCATTTACCCAGATTCGTCCCGGGTGAAGTGCATGTC
CTGCAGCCCACGCATTACCAGGTGACCAATCTCCGTTGGAAGGTGGTGTGTACGCTCATACACCTTCGAAGCCACGTAAAAACAGCACATTAGCGTTGTA
AAGTTGTTGTCATCCCCAAACGCGTTCTGGACCGAATTCCACTGCGCGTCCTCCGCGTCGCCCATGACGTACGAAATCCTCGTAGGCTGCTCAACGACTT
GTAAATACACACGACATAGTGCGCACAGCGCCTCAGTGTAATGTTCTTCCTTCCGTTGTGAAGAATTAAAGATCGCTAGCAAATGAAACGATCGGTTGCT
ATCAGAGATCCCAACAACAAACACAGGATACCACGCTTGCGAGAGCTTAAACGTTGCATCCATGTGCAGGATGAACGAAGCAGGATCACACTTAGCTTTC
CGCAGTAGGTTCTTGGCAGAGATGCGGACAAGAAACGGATCCTCGTCCGTTCCACGGCCGACCCAGGGCTTTCCGTCCGCAGTCATTCGCCACGAAAACG
TGAAAGGGGCATCGCGTGCCTCCTTATCGGTAAAACCGGCGTCCCAAATGTCTTTCGTGGCTTCATCGATGAAGTCGTTGTTCTGCAGGTGGGACCGGGT
GTAGTGATTGATAAAGCGCTGAACTACTTGCAGAGAGGGGAGAGTCTCTTGGTCCAGAGCAAAGCGGCTCATCATGCCGTTGCAGATTCTTGACGGCTTG
AGACCCTGGGCTGCCAGATCCGTGGCGAAGGCTTTCATCACAGCCGTCATGCGAGAGGATTCGACGCCTCGACGAGGTGTCAGGTGCTCCCCTCGCTCTG
CGATGGTCATCAGGTGGAGCTCCTGACACTTCTGGGTGTTGCCGTGCCAACCACAGGGACCACCTGCCGAGGCTTCCTTGCAAGCCTTGTCGCGGCAGCG
GCGCTCAAGCACGCGCATCTTGTGGTGCGCAGCCACATTGCACACGTTGCACGCCGTTAGCTGGCTCTTCGTTATTTTTGATGCTTTCATTGGCTCGATC
AGCATATTGCCGTCGTCCGCAGGGTACGCACGGACGAGAACCGTCCAGTCGTGGTACTTGCTAGGCTTGGAAGGCATGGTGTTGGGGGCGCTGAGGGGGC
GGAAGGGAGCTAATACGGGGTTTGAAGGTAAATCTCAAGTGCTGGATAAGGTGTTACGGCTGTTGAACCTGCTAACAATTGCCTATAATTCAGTAATTCA
GCTGCCCTGATTTGGTAGCTCGCGGATAGATACACGAGCGATGATAATGGGTGGTGTAGGGAAGGTTGGCTGTGCTGCTTTCCTACTGGCAGTGCTCGTG
CTGCAATCCTTGGTGAAAGTACGCATTGTGTGGTGCTTTGCTGCAATCTTGGTTACGATTATGCAGTTGATGGTGTTTTTGACACGCTGTCCTACTGGAC
ATGATGATGTCCATTAGGATTATGCCAAATTCAGCTGTGCAATTTAAGCTAATCAAAAACACATATTCTCCGTCCTAGGGACACTATGATGCCCAGGAAT
TGCTCAGGTCAGTGCGGTAGCGAAAGAGTTAAGAAGGCAGCTCCCAAGGAAAAACTCGGTCAGTAACCTCGCCTTTTTTATCCCCTGTATCATCCGCCAC
TGTTGCAGACAAGTGCTGGTCATTAAGTCCTACCAGGTAGCTACAAGTAAGTCGTTGAACTACCTCACCACAACTCTTTGATACCTGGTTGTTAATATAT
GAGTTTTAGACGAAGGAGACTTGGGCAGTAGTCGGTAAGAAGAGTTATAATTGACAAAGTTAATTGTCGGCACNAATCATAAATCAAAGGTAATGCAGAC
TACGTTATTTGTGATCATAGTCCTAGTGTACAAAACGGTGTACTTGAGTCACCGATAGGGCACATCTTCAACAGCCTCTCTGTGTCCTTAGGAGGCTCAA
ACATATGGTGCAGATGATTTGCATCTGGCCTGATCTATGGACCATAGTATGGTGTTGGGACGAGTCCTACCAAAATCAAGAGTTATAAGAGTAAGAGACA
TAGGCGATAGGGACATTATGCCGCACGATGGAATAGGAGGATACTTTCAACCTTTACCGTTTAGTTTTGTTGGTAGTTGTTTCTGTCTCCTTTGCATTTT
CATATTGCAATTCGCTACATTTCAAGCAAGTCAAGTTTATCAGCCCAAGGAAATCGCCAGGAGAAGGTATCGTCCATATCGATTGCATGGACGTGTATCG
AGCACAGACAAGTCGCCAACACGTCGACCTacggagcagcaacagatgCGAGCCTGACGCTATAGTCTGGGCTAGCCCCGAATGGATTTTATCTGTTCGG
TGTGCGAAATGTATCTGTTTGCTGTTCTAGTGGGAAGATAGATGTGGTGTGCTTTGTTAGGGCTCTTTACACTTGAGTTTT