Description :
From Genome Similarity Track
Location :
Scaffold_824:2- 3945
Sequence
3943 bases(100 bases per row)
GTCCAGCACTACGGCCGCCTCGGCCTCGTGCTCGCGCTAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCACCAAAGCTCCACTAGGAGCA
GGGTGCGACGCACCCAGCGTTTTCGACTTCCAGTCGATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCATCCAGGT
CTAAGACCAAATAGCGTTCCACGCTATCGAAGTTCTCAAAATTCACTCCAAGGTCGACAGAGACCTTCGACACACTTACCAGTGTCCCCGTCGCGAGACG
GACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCTTCAGCATACAGCTGACTCCCTTCTAGGGTGGAGCGACGGGCGTAGTTGCTCGAGGCTCCCGAG
TCAATCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGCCCAGCAAGCCCGGCTTGCACACACTCTTCTCGTAAGAGAGCTCAGCTC
TCTTCGGGGCTGAGCCCCGTTGCCCTATACCTCTTCGAGGCACAACAGAACTCAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAGTTGCCGTTT
CCCGGCGATGACCCGGAGGGTTGGCTCGCCGGAGCCTCGCGCTTCTTGCGCAGCGGGCAATAGACCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATC
GGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGCTCGGCTTCTTCATCTTCAGCATAGCTGACGTCCATCGGCTCTGGACCGCTCGAAGATCTTGCGCT
ACCAGCGCTCCAACCAGGTCGCGCCGACCTGAAGTTGTGCTCGGCATTCAATGCCACATCCACCGCCTCTTCAAAAGAGTTAGGGTGTACACGGAACACT
TTTTCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCCGGAAGAGGGTCCGCCGCCATTCCAGCGATAAGAGTTCT
CAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTGGCAAGGAACTTTGACCGGATACGGTACGCCTGATTAGGCGGCGCGAACACGCGC
GAAAGCTGTTGCTTCAGCTGATCCCAAGTGGGAAATGCAGCGTCAATAGACGTGCCGCACGTTAGTGACCATTCGCGAGCGCGACCTCCAAGCCTGGAGA
TAGCCAGCGCCACGCGCTGATGCTTAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCC
CTCGAAGGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTGCGGTGCTCATCTTCTCTTGGACA
TGCTCCAAGAGCGCGTTCTCGTAGCGGGAGAACGATTCCATCCTGGCCGTGACCGCCTCTGGACCTTGCGATGCAAGATGAGCCACGCCCTCCGGGCCAA
GCAAGGACATAAGCTTAGTAAGCGCGTCCTGCTGCGCCAAGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGATATAGTCAACCGACTCAG
GAGCGGTATTGACTACAATTGCTACCAAGTGCAGCGGGGATGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATATTAAGTTC
CTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGG
CCAAGCCGCCTAGGGGTAAATGTATCTGTTTAACTATCTAGCATACTTAAACCTAATCAAATGCATAACGTGTGGCTTTCGGCCAACGTACTGAGAGACC
TTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCATGTAACCCCGTTACAGCCGGACTC
TCAGAGTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGACCTAACGCGGGGTCACTATCCCGAATCAGTGACCATTTCAAGTGATTAGAGAGGATTT
GGATTGTCCGGCGCGGATGCAAGTTGCCTGTGGTGGATTAACCATGACGAGCAGCACTCCGTATGAAACGACGATGGATCTGGTATGAGTGATGCACGGG
AAGGCAAGATCCACCAAGACTTATCTCGGATCCACCCTTACCTGGATCCACTTGGGTGGATATGGGATACGCTATGTACGGGTGGATCGAGTGTGGATCC
TATGAAGGAATGGTGGTAGGTGTCATCTGAAGGTGGATCTAGCAGCCACGGCTAGTGAGAAGTCAAGATCCACCGCGAGGTGGCCCGGATCCCATACTTC
CGAGTTCGGATCCATGGAGGAAGGATCCCGCCTTGAGGGACCTGGATCCAGGGTATAAGGATGAGGGATGCAGTGGATCTCGAACTTTCGTGGGACAATG
GAGATCACAGACGGTTGCAAGATGATGTTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACGATTACAGTGAGGTGGATCCAAGCGACCTGGATCC
GGATGAGTGTACCCATAATGGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGG
GCATGCAGCCGAGCCTGGTAAGGGATTTAACAAGTAAAAGACATAGAAGGTAGATATCCAGGCAGGTATAGGCTTAAGTATCAATACAGACCTCAATTTG
CACAGTAACGTGCAAGTGCCTTCCTCCCCTCAAGAATCGGAACCCCATTGGCCGTACGAGCTCGGAGAAGGTTGGGAAGTGTGAATCTAGTGTTGGTAGT
GATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTAAGCTTTCCTATACACGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTA
CACCCTAGAGGCTCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGTAAGGCAACCC
TACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGCTTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCT
GCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTA
CACAAGGTGAGGAAAGTTCAGCAGAACACAGGTCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCGC
AGATTATGCTGATCCCGGTACACCACAATGGTGCGCGTGCCCGTTTCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGA
TTGAGCCAGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGT
CGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAA
GATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGTCAACACCGTACCTAATCCCAAGCCCACTAGTCG
AAGAAACGAGAAAGAAGAGGAACATGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTC
CGACAAGGATCACGAGTTTGTGTATCGCCACCAAGCTTTACGC