Description :
From Genome Similarity Track
Location :
Scaffold_1377:2- 3824
Transcript NameFunction/comments
Physo_126686reverse transcriptase

Sequence
3822 bases(100 bases per row)
CTGTGCGTCGGCTCCTCGAAGCCGATCTTGCTATCGTCAGCGGCCGGAATGCGCCCAACAGGCGCTGCTGGTGGGCAAGGCGAGAATCGGGACCGAGGCC
TTCTACGCGGTTGCAGGCTGCATGCGATGGCTCATCAGATGTGTAACAGGGTTACACACACAAGCGGCTACAGTCACTTGTAACTCTAACAGTCACGACG
TCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACAGACCAAAGACTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGG
ATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCTAACCAGCCGTTGGCAGATTCCTATCTTAGAATAT
TACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAATATTATTTGGATCGTTTATCTAGATTAATCTATACTCGG
AGGCCCGAGTATAATTAACTCTAATTTAAACTAGGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTA
CACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGT
GCCCATGGAAAGCTCCACTATGCGTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACA
GTCATTGGTGAGGCGGTTGTAGCTACGATGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGCTTCATCCTGAAGGAGCAACGCGATG
TTGCTGCTACTACCGCGGTGCCGTCCGGGACGACATCACGCGCGCAATCGCTGAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCCCTCCT
CCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATTTCATGTCTTGGCGGACGTGCA
AGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAA
ACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTGGAACATCGT
GACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATTGGCCTGTGAAGACCAATCTCTTCCGTGAGTACCTGAGTACT
CTCGAAGCTGCAATCACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCACGCCGAGCGGCATACACTGGGAGTGGCTGGTGATGCCGCAGGGGCCGAAGAACG
CCCCTCCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGC
AGACGGGATGAGTGATGTTGAGATGCGCAAGGTGCATCTCCGGAAGCTGCTTGCGCATGAGCGCAAGCAGAAGCTCTACGCGAACCTGAAGAAGTGCATC
TTCGGGGTGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATGAGTGGCTGACGC
CGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACACCCGCTATCACAGCT
CCTGAAGAAGGACGCCGAGTGGATTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCTGATCTTGGCGGTGGCC
GACCAAGATCGCTCGTTCCAAG