Description :
From Genome Similarity Track
Location :
Scaffold_1240:2- 3794
Transcript NameFunction/comments
Hyaar_Emoy2814638hypothetical protein

Sequence
3792 bases(100 bases per row)
GTGTCGTGTACGTACCCGGTTCTCCTTTGATGCCAACATAGTTTATTACACGCCCAAGATACGAAGCAACGCATGTACTCTTCTCCACCGTCTATAGTGA
GTTCGCTCACATTCAGCGCTCGACTGGTGAAGTAACTGGCCAATACACGCCCATCATATTCTTGGATCAGGGCCTCTGAAACAGATTACTTGCAAGCGTA
AACCACGATCACTGGAGGGCGATCTGGGTCGAAATGTCGTAACGTCGGAGTTGTAGCGATGTTTGCTTTAAACATAGTGAAATTCATTGTAGCCTCTTTC
CATCTACTATTGCTTTCGTCTCAGACCGCTCGTCTTTATCCATGCACTGAAACCGACCGATCTCATGGAAAACCGCTTCTCGTGATTCATACAAACAGCA
GCATAGATTTCTTAGTCTTCAATGAGACGGCTGTAGTAGTTCAGACTTCCTAGAAAGGATTGCATAGCCCGTAACATGCTCGGAAACGGGATGTTGACCA
ACGATTCCAAGTCCTCGGCCGAGACCTGATGTCTTAAATAATCGACCTTCCGACAACCCCAAAAAGCATTTTGCAAGACTGATCGACTAGTTCCACTTGT
TACACGTTCCTAGCAATCTTTCCACCTTCTCGTATAGAGAATCCCACGATCTTGCCGGTGTAAGGATATCGTCGATGTAGGATCTCCGCCCAGTATGGAT
GGTTGCCGATCTGTCTCCCGTTCACCTTCTTTGACCACGTCGATCTTCCCTCCTGAGGGCAAGCCTTTGCCGATCTTAAGGTATCCATAAAGTGCATTGT
CAACTAGACGTTGGTAGATCTTAGGCGCATTCTGTAAATCGAAGGGCATCCAAAGCCATTCGAATAGTCTGGACGGTGTAATTAATATTGAGATCAGCTT
CGCCCACTCAATCATTTCAGCAACCCAAAATACACTTGCAATGTCCAACGAGTAGTACCAAAGGGCTTTAACCAGATCTTCCAACCGATCGCTGATCAAT
GGCATTTTGTAAACCATCAAGCAAGTCGACTGCTTCACTCTGCGATAATCGATGCATAGGCGAATGTCAACTCCATTCTTGTTGATGATCACTACGGAGA
AAGTTGACTACGTTTAGTATTAGGAAAAACGGATAGGAAAGTACGACGGGGCGACTTCTCAGTGAAGTACAAGTCTGGGTAATCTTTGCCGTCAAGAGAC
CTTTGATGAGATCGGAAAAATTTCTCACGATATTTGGGTGCTACTGGCCGAACTCGTTGTGCTACGGAGAGGCTGTGCCCACATCTATATCACAGATCGC
GCCGCGCGGTACTGGAGGTAAATTGTTTGCCTTTACCCATAAGGAGGTGACGGCTCTTCCAAATCAGCACTCTGAGCTTCTGCTGATCTGCCGTGAGAGG
GACAATGGGATCTCCGATCTGAATATCGTCGATAGTCACCACTTCAGCTGATGGTGCTGCTTCTGGTAGAACTGCCATACGCTGCTCCACATCTTCAGTA
AACAGATCACCACTCTCATGGAATAAACTGGTGTATCTGCATTCTCATTTTCTCCGATCTCTGACGGAAACGCTTCATCTGAGACTTTCTCCTGTTGTTC
ATAATCCGGTCTGACTCCTTTACCTACGGATTGGGACTTATTCTGCACAACCCATCGTCTGGTGGTTGGAGATCGGTCTCGCGGTCCTAATTTGATGTCA
ACTGAAGCGTACCGTCGCGCGAGGATAGATGAGCAGTATCGATCTGTCCTTCTGTTAAAATATCAGCGTCTTCATCGTGTGATCTTCTTTCACCATCCTG
CTGTCCTTTCACTGTGTCTACCGATGGCACGTCCTTAGGTTTGGTTGTCGGTAGTTTCATGATCTGTTTGGGAGTAACATATTCCGGATTGTCTACAAGT
GGTCCGGTCCACTCTTCAGGCGGTTCTTTCAGCTGATACACCGTCGGTAGCCTCATATGCCAGCTTTTTCCATTCTTGATATCGGCGCAATACCAATGAC
ACATAGCCTGGAGTTCGTGGTATCATATCGCCTTCCATACAGATGCACAATATGACATGTGTGGGCAGAATGATTTCGCGATCGCTGAGATTAGTCATTC
GCAAATATATCCTCTTGCCGGATTCTGTTATCACCGTTGGTATCCAAGTTGGACTTCTCGTGACCCATAGCTTCGCTTTGGCATTCTCGATTCCGACCTT
CACTTCTCTTGACTATCAAGCGGGGATCACTATGTGTTGAACTATTGCGGTTATATTTCGAACCGTCGTGTTATACGCAGGACGTCGTCCGCAGAGGTGG
ATACGAACTTCATCCGGCAGACACAGTGTACCATCGATTAGATCGAGACGCACCCCGGCGGGTACCATGGAGTCCATCTCCAGGATGGCTTCTTGTCCAG
ATTAATCTCCCACCCAAACATCGATATAGTACACTAGCGATCCCGCGAGATTGACCTTGATCTTAGTCTGTCATGTCGTCATGTACAAGCTCTCGCCAAT
CTCTATAGATTCTTGTCGTTTACTTTCGTCGATGACACAACCAACCTTACGAGCGAAGGCGTTGTCAATGATAGAGACTTCAGCACCAGAATCGAACAAC
AGGTTTGCGTTTTCGTTGTTGATATTGCCGACCGCTTTCTCCTGCTTGAACCACTTATCAGGTGCGTGATATTTCCAATCTCCGCGCAATTCCTCACGAG
CCAGTTCATTATCTATCGTTGGTTCCGATCTCGAATGCTAGTCGATCTTTTTCAAACTAAAGACGTTAACGAACTGTTGTGGTTTCAAGTGAGATACATT
CGATTCCATATCGGTTTGCTGCTTGCTCTCATTATCTATCCGTTTTTCTCCACAAATGCAAAAAAGAGACAGCCCAGAACGCTCGGCTCGTACCAGATTC
CAACCTGGCGAGCGTTCTAGTTTAACATTTTCTTGTCCTTTTCTGTCAGCATCCCTGAATGTTTAGTGGGTACATACCACTGGCGGATCATGTTATAGAA
CTCCTCCATCGGGCATTTCCCCGGGATCATGCATCTCGCCACAAGCCCAGAACACGAAGAAATAATTGTGAGGGATGCCCGTTACGACCACACTTTTGGC
ACATGAGCCGCTTCTAACATCCCAGGTCGCCATGTTTAGTCGATCCGCAATGAGTACACGGCTTACGTGGGTATGCCGCATCCTTGAAGATCTTGGCGAT
TGGCGGGGTCCGTCGACTTCGGGTGTTCCAAAGAGCCACTCGTTTGTTTCTGCTGCGCTGAAGCTGTAGTTACATGGATCAATTTTAGATGATCCTCCGA
TTCCGTTCCACTGAAATCAGATTACGACCCACTGCTGTTATCTTCCGTTCGGATAGCCCTCACTACTTGCGCGGGTTTAGATGGCCCCGGAACTAATGCC
ACCTTCTGTCAAAACTTGGACGACCCCATCAGTGCCTTCCCATGGCGCGATCTCCCACGCTGATAATCACGCGGCGTTTTTTTTCATCGTTGCCACGTCT
TCCGCACACAAGAGCAATAGTTGTCTGACGAGATATGGATCGTCCAGAGTATCGATGATCGATGTGTTCCTCGCGCTCAGCTGGCAAACCGCTCTTCACT
GGTTATTTCGCTTGCATCCCAATCATATTGAGACGGTGCATATATTCGAAAGGCGTTTCATCGGTCATTTCTTTGCATGGTAGTATCTTCACTAACGATA
CGCATGTCCCACATATCCCGCCAAGAAACTCTCCATTATATCCTTCCACTTAAATCGTGTCGATCTGCTCAATTGATTATACCAGTAGCGGG