Description :
From Genome Similarity Track
Location :
Scaffold_607:2- 3786
Transcript NameFunction/comments
g16373.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
3784 bases(100 bases per row)
CGCCATCGTCTTGGCTCGCGATCACGTCGGCGCGTGCTCCCGACGGGTAGCGCCGCTTCCAACGTGGATCGTGGGTCCCATCCGTGGATCAGATAGAACG
GTGTGTCTCCACGCACACGATCGTGGGCCGTGTTGATTGCGAATGTGAGGCGTTCTGCGTACTCGTCCCAGTCCTGTTGGTTAACGTCTGCGACGTACAT
CTTCAATGCTCGAGTCAACGTCTGCACCATACGCTCGGCTGTTCCGTTTGCCTGGGGCCGGTACGCCATCGTGGCTCTCTGTTTTTGTCCCACGATCCGG
CTGAATGCACGGAAGAAATCAGACATAAAACCGGGTTCTCTGTCGTGCCGGATGGCTTCACTGGCTCCAAAACGGCGGAATACACACTCTTCATAATTCT
CCGCGATCGTCTGGGCCGTCCTTGACGCACTTGCTTTCGCGATCACATATCCCGAGAACAGGTCTACCCAGATCAGCAGCTCCGTGTTGCCCTTGAAGGA
CTTGGGCAGCGACGGAATGTGATCCATCGCGACAATCTGGAACGGGTACGTCGCTTGCAAGTTTCCGGGGGACTCTCCTCTCACGAAGGGTCGTCCTTTC
CCTGTCTCACAGTCTGTGCACTCTCCCACGTAGCGTTGGACACTTCGGTACAGGCCTCTCCAGTGAAAATGCGATCGGATTCGTCGGTACGTTCTTCCGA
TCCCCTGATGCCCTCCTTCCAGACTCGCATGATAGTGATGTAAGAAATCTTGCTGCAGAGTCTCTGGGACCACCAACTTTGCGATCTCATCCCGATCCTC
GTCCAGCGTCATGGATGATGGACAATAGAGCAACAAGTCGCTCTCGTCCAGCTCGTAATCGTCCGCGATCTTCGCACACGACTTGGCTTCCTTCGCAGTC
AAGCTACCGACGTCTCCCTTCAGGTACGCCTTTAGGTCGGTGATCCATTTCTCCTCATTCTGGGCTTGGACGACTCGCTTACTTCGCATGCGCTGAATGA
TCGTTTCCTGCAGAGCCTCGGGCGGCAATCGCCGACGCCTCGTTGATCTAGTCACCGCGGACACCCGGACAATACTGTCGTCATCCTTCGGCTTGAGAAG
CTCATCCAGACGGTTAAGTGTGACCAAGTCCTGCCGATCACCCTCTGAGGTAATCACAGTTCCTTCTTCTCGTTGGAGAGCGGTGCTCGCTAACTTGTCT
GCACTCTGATTCCAGTCTCGCTTCATGTGCAGGAACTCGTGTTTCGGCCACGATCTGAGCCGTTCCATTGCCTTTTGGCGCAACAGCAACAGACCTGGTG
CCTTACACGCGATCTCACCACGCATCTGGCGGATCACCAGGTTGGAATCACCGCAGATCACGATCCGCCCCCGGTCCAAAGTCGACAGCAGATCAAAACA
CAACAACAACCCGCGGTACTCAGCTTCGTTTACGGTCAGATCGGGCATGTACTCCGACGCGGCGGTGACGATCGTCCACTCGGGGAGCTTCCATACGATC
GCGCTGTAAGCCCCACCGCTACGTTTAACACGTGCTGATCCATCGAAGCTCGCGACTAACAAATTCTCGTCTGCTTCAACCGTAGGGGATGGCATGAGGA
TCGTTTGTTGAGGTTGTTTCACCGGCGCAATCGCGATCAGCGCTTCGTCTACTTCAGCGCGAGGTGTGATGCTTGCTGCAATAGCGCCGAGGATTTCATC
TTCCCCTTTCGCGCATTTCCGGATCTCTAACGTCCACTCTGAGAGCAGCGCAGCCCAGTTGCCGAGTCTTCCCTGGAAACCGGCTGAGTTGACTAGCCAA
GCCAACGTCGAGTGCCTGGACAACACCAAGATCGATCTCGTCGCCAGCAAGGTGTAATTCACGTCCAGCATCCGTAAAAGCGCCAAGACTTCCTTGTCGA
CGATTCCGTAGTTGAGCTCGTTGGACTTCAAAGTACGACTGGTGAAAGTTACTGGCCAGTACACGCCATCATGCTCTTGCACAAGCGCCGCGGAGATCGC
CCATTGACTCGCGTATACCACGATCACTGGAGTGCGATCGGGATCGAAATGTCTTAGGATCGGTGTGGACACGATTTTGGCCTTCAGCATTGTGAACGCG
ATCTTCGCTCGGGTCCAACGATCAGCGTCCGGAATCTGTGGATCGTCGCCCCCAGTCATCTTTTGGCCAGGGTTGATCCTCTCTAGGCGGCTGATCTCAT
GAAAGTCCACTTCGCGCAGCTCGTACAAGACGGCGGCGTAGATCGCAAAGTCTTCAATGAAGCGACTGTAGTAGTTCAAGCTTCCAAGGAACGACTGCAT
CGATCGCAGCGTCAGCGGGAAGGGGAGATTACTCAGCGCCTCAAGGTCTTTCGGGTGAGCTTCCAAACCCTCAGCAGACACCTGATGGCCCAAGTAACCC
ACCTTGCGCTGGCCCCAGAAGCTCTTGACGACGCTGATCGACAGATTCCAGCGTTCGCAAGCGTCCAACAACCTCTCAACCTTTTCACATAAAGCATCCC
AAGTGGTCGCCGTAACGAGAATGTCGTCGATGTACGACCGTCTTCCCAGCACGGACGGCTTCAACTCCGGCTCTGGTTCCCCTGCCTCGAACACATCAAT
CGGCGTCGACAGATCATGGCTAGCGCTGATTCGGAGATGCCCATACAACGCATTGTCGATGAGCCTCTGATAAATCTGTGGAGCGTTCTTCAGCCCAAAA
GGCATGCGCGTCCACTCGAAAAGTCCGAATGGCGTGACAAAAGCAGAGATCTTCCGAGCTCGCTCAGTCATAGACACCACCCAGAAACCACTGGCCATAT
CGAGGGAGCAGTACCAGAGCACCTTGTCCAAGTCTTCCAAGAGATCGTTGATCATCGGCATGGGATATACCATCAGTCGTGTCAATCCGTTCACCAGCCT
GTAATCGATACAGAGTCGGATGTCAACACCGTTCTTCTTGATGATGATCACGATCGGGGATGCCCACGGCGAGGTCGACGGAACGATCATCTCCGCAGAC
AGCAAACTCTTGATCAGGTCCGACAGCTTCTCGCGAAACTGTGGGGCGACCCGGCGAACGCGTTGGGCGACCGGAGTTGCTCCCCCAACGTCGATGTCGC
ACACCGCGCCTACAGCCGCCGGGGGTAACGCGTTTCCCTTTCCGATCAGTAGGTGACGCCGGCGCCAGATGATTTGCCGCAGACGATCGATCTCCTCAGG
GGTGTTGAAATCAGGGTCTCCCACCTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGGTTGCTACCTCAGGCAAGACAGCCATCTGCTTTTCCACATCC
TCCGCGAACAAGTCGCCTCCTTCATGGTAACAGACTTCGTCGTCATCTGGTATCTCCGACTCGGTGATCGGCGGCGTCTTCGGCTCGATCATGGGCGCTC
TTCCGATAGGCATCCCGTCACTTCGCTCTTCCATTCTGTCTGACGACATCTCCGTCGCGATCGGATTACCCTCTTCGTGCGCCCCATTGATCCCGGGGGC
ATTTGTCCTCGATTTCGTCTCAACAGGGCGGGACTCGGTGATTTGAGCGACCGCTACTTTCGACGCCCCGGAGTCTCGACTCCAGATCTTCGTCGGTGTG
ACGTACTGGGGTCGGTCTACCATCGGTCCAGCGGGTCTCGTGTCTGGTTCTTGCTCGGGTTGCTGATCTGTTGTGGCTTGAAACGCTAGGTTTTGCCACT
CAGCATACCGGCGTGACCCGATCAATACGAAACCAGGAGCACGGGGTACGCGTCCTCCTTCGAGCCACATGCCTATGTGGGCAT