Description :
From Genome Similarity Track
Location :
Scaffold_1908:2- 3748
Sequence
3746 bases(100 bases per row)
AGGTACACCTCCGATTGAATGTTGAAGCTCCTCCGGTTCAAGTTAGCTACCTTATGCGTAGACACCGCACTCGAAATGCAACATTAACAACGGATTCGAC
TAAGATGTTGCGGGACTTCCCCTTGATGAATCGCATACCCATGCGTCGGAGGGCACGACGTAGGGACCGCACAGAGACAAAAATAttttgctcttcttct
gcttggggGCTGCAACTGGCTTTCCACTTTTATTCATTCTGGAAACCAATTTTCGCTCCAGGGGATGCAAGCTCTCCCCGCACGTACGCGGTCTACCAGG
TGATTTTTGACCTCCCATCTGTCATGTTACAGCAACAGCACAGCGTACAACCTACCGAGGTGAACTTCCGGTCGTGGTGCCTCTCCCAGTGCGACCAGAT
CTCCGAAATGGTGCTTTTCGCAAAGCCCAAGCACTGGTGAACATAATTGCGCACTTCACCTTTCCATGCCTTTGGTGCCGTGTGCATTCGTAGGTCTTTG
CAACGAGATATttttcagcagcagataGTTTTTACCGGCCGTCATTTCACTTGTGTGGATTGTATACTGTCGTTGTGCTTGCTTTTATATTTAGACAAAG
AGCTTTCTAATGGTGGTAGCTGCAGTTAAATGGAGCGGCGGGTTACTGAGAAACGATTCATCACAAATTAGCGCACTAAAAATACAATTTTCCGTCCGAG
GTTTTTGGCCGGGATAATACCTGATGAAGTGGTCATCCCACTCGTCAAGTCGAAAAGCGCCGAACTCAGCGCACCGTCTTATGGTAGTCACGTTATAGGC
GGTCCTTCGGAAATACTGACCATTCCAAGTCGGCTGATAGCTGAGTTCAAGTTGAGACGTCGTCAACCTGACGAATCGACTCACGAAATATGGGTTCGAC
GAACAAAAGGTTGGATCCCGACGGTGACGCACAACACAAGTGGAAGACCCACCCGTGTGATGCTcacgagtacgagctgcaggttAACAGGGTGTTCGGC
TCATTTTCCGGTGGTATTGTGGGCGCCGCATGGTGAATTACCACCTGACTCGGGATATGTCCGGCTAAACTCAGCGAAATACCGAGACTGGCAAGTACTA
GCGTATGAGTCAGCCCTCGATAAAGACTTACTCCGGAGAGAGCAACAGTTATATGCTGAATGGTTAGCTCGTCAACCCCCAGTGGTGGAGCGACGATCGT
ACCGTACTCCTGAAAAAGTGATGAGTCGGTCGAACCGAGGATCGCCAACGGGACGAGCTAAGCTGACATGCGCTCAACGATGGGAGCGAATCGGTGAGCC
TAGCGGCTCAGAAGCGGATGGTAGAGACGCTGATGATGAGGCCACCCAGAACCTGAACTCAGCGGGTGCACCATTAGGCTCAGCTGAGCTCGACACCGCT
GAGTTCGTCAACTCGGCGGATGCACCACTGGATTCAGCTGAGTTCACCGACGTTTTGGATTCAGCGGACATACAGTCTGACACTGCTGTGTTAACTAAGT
TCTCGAactcagcagctgcagagtCTCTCGAGTCGATGAAAGAGTTATTAAGCAAGGCTGCACAAGTTTGTCATGGAGTCGCAAGCAACGCTAACGCCGA
CAGGGGCACTGCTCGGACTAAATTGGATCGTGTATTTATCGATGAACTCGAGATATGCGACGAAGCCTTGGATGATGACCTAGAGGAAGATTTACGGTTT
CGGTTCGCTGCAGCTACGGCTGTCTGTGAGGAACAAACAACCGAAGCCATCAGTCCACGCCGGCCGAGTTCGAGATATCGGCAAACGTGATTGATCTGGA
AGATTATGCACACACATTAGCGTTCTCGCCAGATTTAACTGATCTGACACCTACCGTTCTCGACTATACGAGCGCAAATGTGNCCAGATTTAACTGATCT
GACACCTACCGTTCTCGACTATACGAGCACAAATGTGGTGTGCGTAGCTCATACTCCTGAAGAAAGTCGAAAactggtggcgctgttgaAGAAACAAGAA
TGCATAATGATTGCGAGTGGTAACGCTCTTCCGCCGCCAGCCTACGGTGCGGTTTGCGATATTGATGTACAAGGATATCAACCGATTaagcagcgagctc
ggcgaATACCTCTACGACATCTGACGAAGCTCTGTGACCTACTGTANATCCGATTGTGCATTGACTACAAGATGGTAAATGCTATCACTGCGATCATGGA
GTATGCGATGCCACTAGTGAATGACTTGCTCACCGAGCTAGAAAGCTACTTGTGGTTCTGTTCATTGGATGCGGCGAGCGGATTTTGGGCAGTCATGATG
ACTCGGCGGGCGAGACGGATCTCAGCGTTTGTCTGTGCATTAGGCCATTTCGAGTGGCTTCGCATGCCGTTTGGCCTAAAGAATGCACCCATGATATATT
AACGTATCGTCGATAATGCTCTCTGGGGGTATGTCCATCCTCGAGGAAGTTGGAGTGTGCATGCTGAACGAGTTCGATTAGCTGAGTTGGCAACGGCGAA
ACAGCAAGGGGTTGATTTGGCTCAGCTGAGTTCGGCACCGCTGAGTTCAACCACGCTGAGTTCCGCTACCAAATTTGAAGCCGACCATAGAGCAACTGCT
CGATCCGACCCAGTGTAGGACTTAGTTGACGGACCGGATGATGACATGTTCAACCGAGGCGAACCCGATGTGTCGATACTCACTCCTATCTTTCAACGCA
GATTGTTTGTGGATGATATTTGCTTCGGAGGAAATACTTTCGATGAATGCTTAGCCATACTTGATTGCCTATTGACACGATTCTCCGAGTGCAGAATCAG
CACTAGCTTCACCAAGAGCATATTCGCGCAACAGCGAGTAGATTTCCTCTCTCACGAAGTCACGCCAAGTGGGATTTCGGCAAATCCGAAGAAGTTGGCC
GCGATAGCTGAGTTACCATTTCCAAATTCCAAGAAAGGCATGCAAGCGTTCTTGGGTGCGCTGAACTATTACAGTCGGTTCATCCAAAACCTAGCAGTTT
ATGGGGCAGTCCTCTGTCAAATTAAAGAAGACGACTTCACGAATGGAGGTGATCTCAGCGCTGCCAAAGCAGCCTTCGCTGAGTTGAGAGGTAAGGTGGT
GCATGCACCAATACTTCGACATTTTGACTCGGCGAGAGAGGTTCACATCATGCTTTTTGCAAACGAGTGGGCGCTAAGTAGCACGCTTATGCAACCTCAT
GAGGATAAGCTCTACCCAGTTCGGTTCTGCGGCCGTGTCCTCAAAGAGAACGAAGTCAACTATCATCCAgctgagaaggaggtgctggccttgCTCCACT
TGTTGAAAATTGACCACACTCTCCTGGCTGGAAAAGTGATTCACGTCCACACCCGGTTCTCCACGCTGGAATGGGTGTTCACATCCAAATCACTCTAAGG
ATGAGCGGTGAGCTTCGCAGTGTTGCTGTCACCTTATCACCTCAAGGTGAAGCGAGTCCGGGAACGGGATGTAGATTTCGCCCAGTTGCTGCNCGCATGT
TGGATTCGAGGTGTCGTTAGCGCATATCGCTCCGCCATCgaagaactcggcgacgGTCCGGCTCGACCCTGAACTCTTGTATGCCCATGTCCATCGCACT
TTCGAAGGATATTTGCTGTCTTTTGATGGATCTGCTAAGACTGAGAAGTATGGAGGTTACGGGAGCTGTTCGTGGATACTGTGGAGCTTGCCAAGTTGGA
ACATTGAGATCGCTGCGAGTGCGCACCTTTTGTCGATCACAGTCAA