Description :
From Genome Similarity Track
Location :
Scaffold_1577:2- 3683
Sequence
3681 bases(100 bases per row)
AGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGA
GGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGCGTTTGAGGACGTGGTG
TCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCTGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTC
TTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAAGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTT
CTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGAC
GTGTTGCTCAACAACATACGCTGTATAGCGCGCTGGACCTGGTGGACGAATACTACCAGATCCTGATGCGCGAGAGGGACATCCCATTCACGGCTGTGAG
CACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCT
TTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGAT
GTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGC
TAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCCCCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGCCGCGGCGTACACCATAGACTT
GCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGGCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGC
CCGGTGGAGAAGAGCGCAGCTCCTCGTAGCGCGGCGTCGAGTCACGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGC
AGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACGGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCC
CGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACATGGCCATGGAGACTGCGAGGTTCTTGATAGAGCGAGG
CAACATCCACACGGAGCCGCTCCACGGCACCAGGCTTACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACAC
ACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGTATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCG
TGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTG
CTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGA
AGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTG
GCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTG
CGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGT
CATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGT