Description :
From Genome Similarity Track
Location :
Scaffold_2420:2- 3655
Transcript NameFunction/comments
Phypl_g15068hypothetical protein

Sequence
3653 bases(100 bases per row)
CGCTCCGCCATCTTCGGAAGCTGTACGAACTTCTGAAAGGGTTGTTGAAGGCTGGCCTGATCGCGTTCTCAGACAGCCCTTGGGCGTCGCCGATTGTGAT
CGTCCTCAAGAAAAACGGCGTGGATATCCGTTTATGTATTGATTACAAGATGCTGAACGCGGTGACCGCGATCACGGAATACACTATGCCACTTGTGGAT
GATTTGTTGACCGATATGGAGGCCTACCTGTGGTTCTGCTCCTTGGATGCAGCCAGCGCATTCTCGGCCATCATGATGACCATGAGAGCTCGGAAGGCGT
GTGCGCACTGGGGCACTTCGAGTGGCTACGAGTGCCATTCGGGCTCAAGAATGCGCCGATGATTTATCAGCGGATGATCAACAACGCTCTGTGGGGTTGT
GTCCAACCGAAAGGcggatggctacacttctcggagctcatgcgggccgcggaggaggaagctAATGCTGCTAGTACAGGAGTGACCGAGGGCTCTCCGA
TGCTCAGTGACGATACAACAAACTGTCCGACTAAGTTCGAGGCCGACCGAGCATCCTCGACCAACATGGATACCGTCGCCGTGCTAGTGAACAGCCCGAT
TGCGGACATGTTCGCTAATAGCGAGCCCGACGAATCCTCGTTGGTGCCCGTGTTCGATCGACGGTCGATCGTGGATGATATTTGCTTCGGCTCAGAGACG
TTTGNGTGTTCGATCGATGATCGTTTATGGATGATATTTGCTTCGGCTCAGAGACGTTTGATGCGTGTTTAGCGActctcgaccagctgcttcagcgctc
CACAGAGTGTCGAATCAGTGTTAACTTCACGAAGAGCATCTTCGTTCAGTCACGGGTGGACTTCCTGTCGCACGAGGTGTCGTCCGAGGGTATACGAGCC
GATtccaagaagatcaaggccGTGTCAGAGTTGCTGTTCCCGACGTCGAAGAAGGGGATGCAGTCGTTTCTTGGAGCGCTCAACTATTACAGCTGGTTNC
GTCGAAGAAGGGGATGCAGTCGTTTCTTGGAGCGCTCAACTATTACAGCCGGTTTGTCGAGGACTTGGCTGTGTATGGAGCTGCTCTGTACCAGCTGAAA
GACGAAGATTTCCTACCGGGGGGTAGCCAAGCGGAGTTTTACAGCGCTGCAACAGAGGGTTGTGGCCGCACCGAAACTGCGGCACTTCGACCGAGACAAG
GCCGTGCATGTCATGCTATTTGCGAATGAGTGGGCTCTGAGTTCCACGCTGATGCAAGAGCACGTCGGGCGATTGCACCCAGTCCGGTTCTGTGGCCGCG
TATTGAAGGAAGCCGAGATGAATTACCACccggccgagaaggaggtgctaGCTCTTCTCTTACTGTTGAAGGTCTGCTATACTCAGCTGGTCGGCCGAAT
GATCCACGCCTACACGCGATTCTCGACGCTAGAATGGGTACACAAGTCCAAGACATTGTTCGGTCGGGCGACCCagtttgcagtgctgctcTCTCCGTGG
CATCTGCTGGTGCAAAGAGAAGGATTGTGTGTTTGCTCAGCTCCTGCAAGCTGGTCTAACGAGCTTTGTCGAGCTTGAGGACTCACTCGCTTTGGTGGCT
CCGCCGACCAAAGGATCACCGACTACTCGAATGGATCCCCATTTGCTCTATGCGCGTCTACCGAGATCGTACAGAGGCTTCGTGATGTCGTTCGATGGCT
CAGCGAagaccgagaagaacggTGGCTACGGCAGTTGCTCGTGGATTTTGTGGCGGTTACCTGAATGGACGGTAGTgatcgctgcgagtgctTTTCTCGA
GACTACTACGGTAAACCTCGCTGAGTACGCCGGAATGAACAACGGCGTCTCAGCAGCGTTAGCCCAAGGAGCCGAGGATTTAATCATCGTCGGAGACTCN
CTAAACCGAATCGGGGAAGTCATCTACGAGCCTGACCCGGAGACCCCAACGGAGACAGAGGACAAGCCTTCGATCAATGTAACCCGAGTCCGGGTTGCCC
ACGACCAACCTCGAAGCAGGAGCTATTTCCATTTCGTCCGGAACGAGCCCGAATACctggcagcaacgacaaggcGGCAAGCGAAGGCGAGAGAGAAGCG
CATACAATTTGCCGACGAAGTGTCGGTGGTCGGCCAGGGCGACTCAACTCGACGAGACAAATCGAATGGTGTGCCTACCGAGGCTCCAGGTGATCTGGAA
GTGACGCTACCGAGCTCGGAAGTCGCCCCCAGAATGCCAACTGCAGACGATGTTGATCCCGTTGCCATACAGGAAGAACATCGGATGCGGATTGCTACCA
cccaagatgaagagctgaGGTGGTCAAACCTCAAGGTGGTGCTacgaggcgaagaagcgaaaCTCGGCTACAAGGCGGCGAGAGACGCATGGAAGATGTC
GGACAAGTTCGTGCTCAGCGAAGACGAAGTTTTCTATTTTCTTGGAGTGAACCGTCGGTGGGGCAccgaacagcaagaagagacGAAGATGCGCCTAGTA
GTACCCACAACGATGATTCAGGAGGTATTACAGAGCTGTCACGACTCGCTGGAAGGCGGTCACCAAGGTATCGGTCGGACCTATCACAGGGTCAGCGCTG
ATTACTATTGAATCGGCCTCTACGCAGACGTGGAACGACATGTGAAGTCTTGCCCAGattgcagctcgagcaagaGTCCACCGCAGTTCCGAGGCTATTC
ACCAGGGAACATCCTGGCGGAAAGGCCTTTCCAAATTGTCTCTATGGACTTCGTCATACCGTTACCGAAGTCTCGCAGTGACAACACGGCATTACTGCTG
TTCAGGTGCGCATTCACCGGTTTCGTGATGGGCAAGGCAATGTCCGACGCGACTGCACTGNGCAGTGTCGGTCGAGAGCAACGTTGAGCTATCGGCCGCA
AGCGAACGGTCAACAGGAACGGTCGGTGAAGACAGTCATGCAGTCTGTACGCGTCTATGCCGAAGACCCCTTGCAGCAAGACTGGGACGAGATCGCCGAG
CGAGTGATTTTCGCTATCAACAACTCACAAGATGGAACGAGGAAGGACACTCCGTTTTGCCTCGTTCATCGTTGGGATGCACAGTCCACGCTCCGAGCAA
TGTCTTCGTCGCCCCAACGAGGCTCTGGCGGCCAGACCGGTGCACTGGCGTGGTGCCGAGAGGTGAACAGACAGCAGGAGATTTCGTGGAGAATGGCTAT
GGAATACCAGGCCACCGAGAAAGCACGGAGGGCGAAGGAACacaaggagctgcttggGAGACGTGAACGAGCGGCGGTACCGACTACTGGTGATGAGAAC
GAGACGTCGGGCGAGATTCCATTGGAGACAGGGACAGCTGACGATGCGCCTGACGCGAGACCGAGGTCTCTTTTCCAACCAGGGGACCGAGTCTGGTTGT
ACATGGAACACGTGAAGTCTGGATTGACCAAGAAACTAGCCCACCGATGGCACGGGCCATTCCgtgtgaagaagaaggtcgaggagTTTGCGTACGAGTT
GGAATTGCCCGATCGGAGTGGATATAGGTTTTACCCGGTGGTGTGTGTCTCTCGACTCATGGCCGTGAACGAATTTGCAGACCGACCGAAACGTCGACTG
ACACCAGAGGTGACCGAAGCTACGCGAGTagacttcgacgaggagttgCTTCC