Description :
From Genome Similarity Track
Location :
Scaffold_310:2- 3554
Sequence
3552 bases(100 bases per row)
TGAAGAGCGTACAAGTACGGATGACAGCTCGCTTTTCTACAACGCAGGTCGTTTTAAAAATTCGGAGCCTGTGATCATCGAAAAATTAAGAAACGAAGGT
ATTTTAGGGGTGTAGAGATCGAGGAGGGTGGAATCGTATACGCTTCACACTCAAACGCCTGCGTGACTGGAATTATCTTTGATAAGTGGCTGCACCAGAT
TTATTTTTTGAATGTGTGGTCGCAAAGAACTGCTTCTTCTCTACAACGCTATCAGTCAAAAATTCAGACGAGAACTCAACAACGTCACTGTAGTCTTTTC
CCGCCTAACTTGACTTCCAACATCCAACCGCTCGATGCGGTTACGCATTAAAATGATGATTTATATATGCGCACCTACATATATGGTAATAGATATAATC
CGATTGTTAAAAGATTGCTACAAGAAACTACGTATGCGATAGCGCATGGATCTGATTGAAGCAAACATGAAACGCAGACTTAATTTCCTAAATGTCATTG
AGTTTGAAGCTGAGAGATGGAACAGTATTGGTGGGGTATTCATTTGTAGTTTCTGGGTCAAGAGTGAGATCATCGAAGCGCCACTGGTTGCGAATTAGCA
TGTACAAATGATTATCGAAAGTCCAGCCTCGCCTTCAAACAAGTCTGCTGCAATCTGGCTGATGTTATGAAAATTGTAGGAGTAAGTATTAGCGTGTGAG
ATTATGTCGCAATCGAGGACTACGAGCAGATTCATGGAGAAGAAAATGCTCTTATTGAAGCAGAGCGGAGACCGCTGAAGTCAAAAGCGATGACGATTAA
GTGCCTGTCAGTGCAAAAGAAGCACTATAGTGCTGCCTGATTTTGTGTTTGTACTTCGTACGCTCATATAGAGACATGCGTATTGTCCAGTTAATCTGTA
TAATATTTCATCAAGTATTCGTAAGAACCGGCACGCTAGAGCGAAACAGCTCGACCTGAGAGACTTCATGTTGTAAACAAACGTTCCATATCATTACATA
TAGGGACATGTTCTGTAGCGTTACTCAAAAACCCAATACTCAATTGTTCAGTCGTTATAAAATCATGCAACTACTTTCATTCATGTTCTCTATCAGAGAC
CCTTTATAAGACACGCTGTAAAAATTGGGCGAAAAGAGTGGCGAGTGTACCACTACAACTGTGGAGCACAAGTACTTCCACCGTACTACAGTCAGCTCAC
TCTATAGCATCCTCTGATCTAATATCGTCCCTCTATAAGATCCAAATCGGGGGTGGACAAACAGGGATGTTATAGAGGGAGATGAATGTATTCGCTCCGG
CGAGAGTCTCACTAGTCTTCTCTATAGCCAAATCCAGAGATTCGATCGCTTCTCAACGTCCATCATACCTTCCAAGGACCTTATCGACTCGACTGTCGCC
CTCGATCGCTTCTCAACGTCCATCATACCTTCCAAGGACCTTATCGACTCGACTGTCGCCCTCGATCGCTGACAATTCTTCCAAGTACGTGAAAACGAGT
CCCTCTCCGTGTTGTAAAAATCTCATCCCCACAACTTCATTCGCCACGCTTCGAATCTACCCGTTCTCAACGTCTCACGTGCTTCAAGACCGTGATGTAC
CCATCCGACGAATTGATATCTGATGCTCTAAAATTGACTGTAGAGTCAGGTTCCCTCTCGCAGACGAACTTCTCGTAAAGTCATTCGCTAAAGTATGTTC
TAGATAGCTCGAGGCTTAATTGTTTGGTTTCTGATGATGCCCTGTGAACTACGGGATAGGCTCCTGGAAGAACGGGCGGCACCTAATGGATTACGCTTCA
AATGAATTAGGCTGACTTCTACCTTGTAGTTATTACGCACCTGCTGACTGGAAATGTCATTAGTTCCACCTTGTGCACAGAAATCTATCGGCACGACGTG
GAATGTGTGAGCTTGTCGAATAGCATGCATGTCTTCGCTTCTCATGCTCGCTCTATAGCGCTAATGGATTAACCTGAAGCTACAGGAGTGCACTTGTCAG
CTGTACGGTTAAAGCTAGGAGTGGTAGATGTGGACGGCATTTGATAGAGACAGCCTCACGGTTGCTTCATTCTGTCGCAGTATGGGAACCAACTGGCATT
GGCTGAGGGACGCCGATGGGATTGCTGAGGTCCCGTGTCCTTTTCAAGCGTAGTTGACGACAGCTTGCCATTGGCACTGGCTAATCTCCGCGTTGGCGTG
TCTGGTCGCAGGTTTGGCGAGGGGATACCATGCATCTATAGCGCTACGTCAGCACCACCGGTCCAGCAGTTCGTGAAGGGGGAAGCTAGGGTCACCTTAA
TGCGCCGAATCTGTTCAAGTCGCTACAGTTGAAGCATGATGTGATCAGCTCGCGACGTGCGCTCACAAGACATGACATTCATCCATTCGCTTTTAGCAGC
ATAGCGCAGATGCACCTGGTGATGCTAACGCGCGGGAGTACGTGCTGAAGCACTGAATGGAGCTGACAGAATTGCACCGAAGTAAATTGTGGACCGTGTA
GTCCTCGTGGTGGTATTCTGCCGCTTCCAGAGTGACCCTCCCTCACGCTCGAGAGGCTGCAGCGATTCTAGAAACGCGCCAACATTCATCCTACCCCCAG
TTGTTGTATGCTGCACTTAGGATGTCCCGTTTACAGGGGTCTGCACCATATATATTCACAAACGAGTCAATGACTAGCTCTAGTCGCTGTAAAGTGAAAC
GCTCGGCCATTGATGGTGCGAGTAACTTGGCACTGTTCGATCCAGCTGTATCCTACACAATGCCACAGACGTCGATCAGTAACTCGAGTGCTCTACTATG
GACTTTCATGTTGATGAGAAAGACACTCGACTACTAAATTTTACTACAACATTAAACATTAAAGCATCCGNNNNNNNNNNATGCCTCAAGGTCTGTATTA
GAAGTTGTTCGTTGGGCCATGTTCCATTGATAGATCCCGTTTTTTTCTACGTAGTTTTGATTTCCCTCTAAACATTTCCAAGCGAATGAATTATAAAGTA
AATAAATTTCGCCATTTTTGCTCTAATTTTTTCTGCATTCTATAAAGACGTCCGTAAAACGTTTAAAATCATCCAACAACCAAAAATTGTAAGGTGGATA
TGTATACTTACCCACAAAATAGTCTCTAGTCACAGTTATTGATATCCAAACCAGTCCGCATATAGATCTCCTTTGTGCTTTAATTTTTCTAGTTATCTTT
GAGCTTCCCATGTCGAAAGAGGTTGGACTTATTCGGCTGAACAAGTATTGTTATCTTGAATGTGCGACTATAATAAACTCCCCCTGACCACTCGATTCCG
TTTATTGAGAGCATTGAATCATTTAAGAATACTCTCAAGAACATATACGATCTTTCTGTCTCTTATTTCGTTAATTCAAAAGCCTTTTATATTCTTCTTC
TACAGGCGTATTTCAAAAACAGAAAAGGTTGCGGTGATACCACAAGCGTATTGTATCGAGTTTAAACCTTTCCCCTCCTCTCCATTTAACCCGACTTACT
CATTACATAAACCCCCGTGTGACTGAAGAAATTTTTAATCCCTTGCTAGAAA