Description :
From Genome Similarity Track
Location :
Scaffold_974:2- 3547
Transcript NameFunction/comments
g14464.t1hypothetical protein

Sequence
3545 bases(100 bases per row)
GCTGTCCGACCTTCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAA
GCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTGAA
GCGCTGCTCCTCATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGA
ACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGGCGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCA
GTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTAGGCATAGTCAGGCGAAAGGTCTTTGAAGAATTGGTCCCAAAG
ACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAA
ACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACC
TCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTT
ACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTC
GCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCCAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTT
CGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGT
GAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCACGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACG
TACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCC
ACTGGTTAATAGTGGCGCTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCCCATTGGT
CCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGC
ATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTCTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGT
CCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAAGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTC
GCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCG
ACTATCTCTTCCCATGTAGGACTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACA
TCGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCTCGGCCTCGATCAGGGTGGAC
CAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTTCCTTCGTTCAGCAGTGCATCCTGAAGCCCTCGGTAC
TGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGC
CGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCC
GTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGTACTGAAGCGGATCATACTCCGGGCGCGTCTCGAACAGTCGCA
GAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATT
GTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTTCGAAACTCAGGAAC
TGTTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCT
GCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGA
CCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATTGGTTGGAGCACGAAGCGC
CAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAATGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAA
AGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGC
CGATGGCGTCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAA
ATCGCTCTCTCTCGCGTTGCTCAAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGTTCTTGGTTTACCATGCGTTCTTCGGCGCGTTC
CTCCTGCGTAAGCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTACCCTTCGCGCTTCAGCACGCTCCTCCTGCGTAAGCTGTGATCGGCGCTGGGCA
TGTTGCTCTTGGTTTACCATGCGTTCTTCAGCGCGCTCCTCGTGTGTAAGCTGAGAACGGCGCTCCGCGTGTTGCTCTTGGTTTACTATCCGCTCCTCGG
CACGCTCCTCCTGTGTGAGATGTGATCTGCGCTCCGCGTGTTGCT