Description :
From Genome Similarity Track
Location :
Scaffold_1789:2- 3336
Sequence
3334 bases(100 bases per row)
GGCGGGTAGCATAGGGTAATGGCTATTAGGTCAGTATCGGTGCACCATCTCTTTGATTGCTTGAGGCCCTAGACGACTGGGAGTACCATAGGAAGTGGTT
GATGACCTTCCACTGACTGACTGCAGAATACTTACTTGACAAAACAATGACCAGAAAAAGACACGAGGCCTACACTCGATCTGATTAGTCCCAATAGTGA
AACCCAAGTCAAAGATGTCGATGCTTCCAGCTTGTCGACTGGAAACGTCGTAAAGGTCCTCGGGGGTCTGGCTCCCGGTCCACTGCACGTTGGCTAGCTC
TTACATCAATAACCAACAGTTGTAATAGTGGCGAGTACGCCGACGACTACAGCAGCACCAGCAACGACGGCCCAAACGCCAACACCTTCGCCGTCACCGA
ACTCCCAAGCAACAGACAGACGTTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGT
TCGCAGGTCCCCTCTTTAGTTAAAAGAGAGCGAAGTGACCAAATTAAGGTAGAATGTAAACTGAGTATATTTATAGGTAGATAAAGCTTGGGTTTAATAC
AAACTATAAGTCACCTATAGAAATGCAATGTCGTTAACCAATGGTTGGCTTTGAACGACCTTGGTACTTTGTACCAAATATCCCGAAGTATGACGTGGCA
TACTTCTGAAGTGTGAAGTGTCACACTTCATTTAACCAGGGTACACTTAGGGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGACA
AATCAGAATGAAGATGTGTTCGTCACAAACTCTCATTCTCACAGTCGAAAACCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTCACAATTAGA
GCCTCGAGCAGCGGTCTGTGCACTCTTTTTCTGGGTCTCCACTTCGACCGTTTAATCATGCCTCGTGGCACCGCTAAGAGCGGTGCGAAGACACGCTCCA
AGGCTGCTGCCGGGAAGGCGCAAGCCAAGAACACTAAGCCTCACGGCAAAGGCTCGGCACTTAGGGGAGGCTACTCAGGTAGCCTCCGAGGCGATCGGTT
CCCTCGGGTGACGTGCCTGTGGGGCAAGCGAGCAAGCAAGCGCCGCAGCCCGTCGCCCTCGGCCCTCTCCAGTCAATCGTCCGAACCCTCGGTTTGTAGA
ACGTGAGTTCGACGCTGGCAGTGAGGAAAACGCCGAGTCCGAGAGCACGCACGATGTTCCTGCGGAAGGGCACAGCCCAGTGCCCAGTGAGCACAAGGGT
GACAGCGTGCAGTCGCTCACTAGTGATCAGGGTGATCACAGTCCCAGGACGTCTGTGCGCTCTGAGAGTCCGGCCGTTAAGGCTAAGGGCTCTCCTAAAG
CCGGTGGCGATGAGGAAGAGAATCCTCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGTGCTAACGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAA
GATCCATACAGCCTCTAAGTCTTCACTCCGCGAGGAGAAGGAGACTCAACGCTCCTATCAGAGTATCTTCGACTCCTCGGATGAAGAGAAGGAGAAGGAG
GAAGAAGAAGAAGAGGAGGAGGAGGAGGAGGAGGAGGAAGAGAAGGAGGAAGAAGAGGAGGAGGAAGAGGAGGAGGAGGGTGCTATCGCTGAGCCCCGGG
AGGTCTCGAATGACCTCGACCAGCAGCAGGAGGAATTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGTGGCGCCCGTCAGCCAGGGAGCTGCCAT
CAGCTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCT
AGGGGCATCTACGAACGTGCCCTTGTTCAGAAAGAACATTTGTTCGCTGACAACTTGGCGGCTGCTCGGTGTGTGCTTCTCGCGCCACACCGCATCCCTC
TTAAGGACTTCACGACTTGTCGTACGAAGCCCGAGACCCGGGGTGGTCTCTATCCTCTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGTCCCACGTG
GGGTTCTTGTGAGGACATGTTCTGGGCATGGGTAGAGTCTCTCAAGTATCACCCTCGGAGTTACGGGAACTCCATGAAGATCAGCAGTTGTCCCGCATCC
TGGACCAGCGTGATCTTCGTGTTTGGTTTGCCCACTTGGCCAGCAAGCGCATGCTGCCAAGGGACATCCGGAAGCGCGCGGCTTCTACTGCTCACGATGA
GCGCGGGTACGGAGTGTAATCTACGTCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAATCTGCCGCTGCTTCTGTTCCCAGATTGCGACAG
CCTTCGAGCGGTCAATCAGGAGCCGTTTAATCGGCTCCCACGAGCTCTCGGGGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTACCACGACG
CCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCCAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCC
TCCCGAACGTCACTCTCATCCGAGTGCTTCTTCTGCGGGTCCGAGACAAGGCCCTGAGGTTGACCGCCTTCGTCAACGCGTCCTCGTTCTTGAGATTGCA
CTTAGTCTTGGGATCGGCGAGGATGCTGCCGCCCAGACCGGGAATCAGGGTGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGTTGGAGCGAGAGGTCG
CGAGCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATATGGACGTTACCTTCCGCGCGATCCGACGTATCCAGACTCTGCTGCCACATCCGGA
GTCGCCTGCAGCACACTCCCAGACGTACGCGTATGGTGCGTGCCCGGCGTACTCAGCGTACTAAGCGTATGGCTTCGGACCCGTTCGTATGGAGCTCCTC
CGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGCCCCTCGCTTCAAGGA
GCTGGGTCAAGGGGGGTCGGCGCGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCAGCATAGAACGTTGGGTGCGTCGTCATTGACTTTG
GAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACCGCAAATGGTCCAATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTCTC
AAGAGGTAGGTTCCTCGTGTCTAGCAAGTCCCCA