Description :
From Genome Similarity Track
Location :
Scaffold_840:2- 3333
Transcript NameFunction/comments
g15278.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g15279.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
3331 bases(100 bases per row)
CGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAAGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGT
GGAGAAGTACTCCACCAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTGGTCGTCCTGACGACG
CCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTATACTCAACCTGGA
AGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTTTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACC
ACGAATGGTCTACTCCCAAGTAGATACACTCGAAATTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTATCATGTACCGGGTAATTGCGCTCAGCTG
GCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACAC
AACGTGGAATGGGCGATATTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCAT
TCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATGTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACT
GCCGCAGTTCCTTTACATTTGAAGGCGTTGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTTTTCCCCACGAGACACCCAAG
TACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGTATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGC
ATCTCCACATCCGATTTCCCATTCACAGCCGGGCTGTGAATGAACACGTCGTCGGAATAGCTCGGTGCGAAGTCGCGCACCGAACGCAACAAGTGCGTGA
CGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGAT
ATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCATATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGA
GGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACTTAGGCG
CGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTG
TCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCC
TTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCG
CGCCCTCAGAGATGAGCTGCTTCAGCTCTTCTGCTTCACACGCCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTC
GCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATA
CTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACT
TGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTA
TTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATT
TCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTTGGCTCCCAGAGCCGACGCGCCTTCTTTACCTCGACGCCTAACGGCGGAGTGTCTTT
CGACCAATTGTGTGTCGACATTAGCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGT
TTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGCGATGTCTCTGATGGAGGGTCGCATGCA
CCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCCCCG
GATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGA
GAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCA
AGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGA
CAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGC
ATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGGCGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAG
GTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCTCGACGCTGCTGGGAACCAGCAGCTGTCGCACT
CGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAAC
TCTTCTTGCATTGCAAGCGCAATTGCAGCCT